Symmetry and Codon Usage Correlations

in the Genetic Code

L. Frappat, P. Sorba

Laboratoire de Physique Théorique LAPTH, URA 1436,

Chemin de Bellevue, BP 110,
F-74941 Annecy-le-Vieux, France

E-mail: frappat(sorba)@lapp.in2p3.fr

A. Sciarrino

Dipartimento di Scienze Fisiche, Università di Napoli “Federico II”

and I.N.F.N., Sezione di Napoli, Italy

Mostra d’Oltremare Pad. 20, 80125 Napoli, Italy

E-mail: sciarrino@na.infn.it

Abstract

The ratios of the codon usage in the quartets and sextets for the vertebrate series exhibit a correlated behaviour which fits naturally in the framework of the crystal basis model of the genetic code [1]. Moreover the observed universal behaviour of these suitably normalized ratios can be easily explained.

LAPTH-709/98

physics/9812041

December 1998

blankpage

1 Introduction

It is a well known and intriguing fact that, in the genetic code, 64 codons code the biosynthesis of 20 amino-acids (a.a.) with a structure in multiplets reported in Table 1.
It is also a well known and, at our knowledge, unexplained fact that the frequency rate of usage (codon usage) of the different codons inside a multiplet is not the same.
It is the aim of this paper to emphasize for the vertebrate series a correlation in the codon usage, in the quartets and sextets, which is naturally explained in the framework of the mathematical model of the genetic code recently proposed by the authors [1]. Moreover we put in evidence an universal function behaviour connected with the codon usage, which also finds a justification in the model.
In Sec. 2 we recall the essential features of the model and in Sec. 3 we present the analysis of the codon usage for a set of biological sequences in the vertebrate series [3].

2 The crystal basis model

2.1 The crystal basis

Let us briefly recall some properties of the crystal basis [2]. We limit ourselves to the case of 𝒰q(sl(2))subscript𝒰𝑞𝑠𝑙2{\cal U}_{q}(sl(2)), but such basis exists for any finite dimensional representation of 𝒰q0(𝒢)subscript𝒰𝑞0𝒢{\cal U}_{q\rightarrow 0}({\cal G}) , 𝒢𝒢{\cal G} being any (semi)-simple classical Lie algebra. The crystal basis has the nice property, for 𝒰q(sl(2))subscript𝒰𝑞𝑠𝑙2{\cal U}_{q}(sl(2)), that in the limit q0𝑞0q\rightarrow 0

J~+uksubscript~𝐽subscript𝑢𝑘\displaystyle\widetilde{J}_{+}\,u_{k} =\displaystyle= uk+1for  0k<2Jsubscript𝑢𝑘1for  0𝑘2𝐽\displaystyle u_{k+1}\quad\mathrm{for}\,\,0\leq k<2J (1)
J~uksubscript~𝐽subscript𝑢𝑘\displaystyle\widetilde{J}_{-}\,u_{k} =\displaystyle= uk1for  0<k2Jsubscript𝑢𝑘1for  0𝑘2𝐽\displaystyle u_{k-1}\quad\mathrm{for}\,\,0<k\leq 2J (2)
J~3uksubscript~𝐽3subscript𝑢𝑘\displaystyle\widetilde{J}_{3}\,u_{k} =\displaystyle= (kJ)ukfor  0k2J𝑘𝐽subscript𝑢𝑘for  0𝑘2𝐽\displaystyle(k-J)\,u_{k}\quad\mathrm{for}\,\,0\leq k\leq 2J (3)

and

J~+u2J=J~u0=0subscript~𝐽subscript𝑢2𝐽subscript~𝐽subscript𝑢00\widetilde{J}_{+}\,u_{2J}=\widetilde{J}_{-}\,u_{0}=0 (4)

where the operators J~±subscript~𝐽plus-or-minus\widetilde{J}_{\pm} are a redefinition, using an element of the center, of the generators J±subscript𝐽plus-or-minusJ_{\pm} of 𝒰q(sl(2))subscript𝒰𝑞𝑠𝑙2{\cal U}_{q}(sl(2)), J~3=J3subscript~𝐽3subscript𝐽3\widetilde{J}_{3}=J_{3}, and uksubscript𝑢𝑘u_{k} are the basis vectors of the irreducible representation labelled by J𝐽J (J𝐽J being an integer or half-integer). The labels of the irreducible representation are connected to the eigenvalues of the “Casimir” operator C𝐶C:

C=(J~3)2+12n+k=0n(J~)nk(J~+)n(J~)k.𝐶superscriptsubscript~𝐽3212subscript𝑛subscriptsuperscriptsubscript𝑘0𝑛superscriptsubscript~𝐽𝑛𝑘superscriptsubscript~𝐽𝑛superscriptsubscript~𝐽𝑘C=(\widetilde{J}_{3})^{2}+\frac{1}{2}\sum_{n\in{{\mathbb{Z}}_{+}}}\sum_{k=0}^{n}(\widetilde{J}_{-})^{n-k}(\widetilde{J}_{+})^{n}(\widetilde{J}_{-})^{k}\,. (5)

Its eigenvalue on any vector basis of the irreducible J𝐽J-representation is J(J+1)𝐽𝐽1J(J+1).
Moreover any state in the tensor product of two irreducible representations R1R2tensor-productsubscript𝑅1subscript𝑅2R_{1}\otimes R_{2} is written in the crystal basis as one and only one tensor product of a R1subscript𝑅1R_{1} state by a R2subscript𝑅2R_{2} state [2]. For example, taking for R1subscript𝑅1R_{1} and R2subscript𝑅2R_{2} the two-dimensional representation J=12𝐽12J={\textstyle{\frac{1}{2}}} of 𝒰q0(sl(2))subscript𝒰𝑞0𝑠𝑙2{\cal U}_{q\rightarrow 0}(sl(2)) with states |+ket|+\rangle and |ket|-\rangle, one will get in R1R2tensor-productsubscript𝑅1subscript𝑅2R_{1}\otimes R_{2} the J=1𝐽1J=1 representation displayed by |+,+ket|+,+\rangle, |,+ket|-,+\rangle and |,ket|-,-\rangle, and the J=0𝐽0J=0 representation with the state |+,ket|+,-\rangle.

Now let us state the main hypothesis of our model [1].

2.2 The assumptions

Assumption I - The four nucleotides containing the bases: adenine (A)𝐴(A) and guanine (G)𝐺(G), deriving from purine, and cytosine (C)𝐶(C) and thymine (T)𝑇(T), coming from pyrimidine, are the basis vectors of a crystal basis of the (1/2,1/2)1212(1/2,1/2) irreducible representation of the quantum algebra 𝒰q(sl(2)sl(2))subscript𝒰𝑞direct-sum𝑠𝑙2𝑠𝑙2{\cal U}_{q}(sl(2)\oplus sl(2)) in the limit q0𝑞0q\rightarrow 0. In the following, we denote with ±plus-or-minus\pm the basis vector corresponding to the eigenvalue ±1/2plus-or-minus12\pm 1/2 of Jα3subscriptsuperscript𝐽3𝛼J^{3}_{\alpha}, where α=H(V)𝛼𝐻𝑉\alpha=H\;(V) specifies the generator of the first (second) sl(2)𝑠𝑙2sl(2). We assume the following “spin” structure (we remind that the thymine T𝑇T in the DNA is replaced by the uracile U𝑈U in the RNA):

sl(2)H𝑠𝑙subscript2𝐻\displaystyle sl(2)_{H}
C(+,+)𝐶\displaystyle C\equiv(+,+) \displaystyle\qquad\longleftrightarrow\qquad U(,+)𝑈\displaystyle U\equiv(-,+)
sl(2)V𝑠𝑙subscript2𝑉absent\displaystyle sl(2)_{V}\updownarrow sl(2)Vabsent𝑠𝑙subscript2𝑉\displaystyle\updownarrow sl(2)_{V} (6)
G(+,)𝐺\displaystyle G\equiv(+,-) \displaystyle\qquad\longleftrightarrow\qquad A(,)𝐴\displaystyle A\equiv(-,-)
sl(2)H𝑠𝑙subscript2𝐻\displaystyle sl(2)_{H}

Let us remark that the H𝐻H-symmetry is associated to the purine-pyrimidine structure, while the V𝑉V-symmetry reflects the complementarity rule (that is AT/U𝐴𝑇𝑈A-T/U and CG𝐶𝐺C-G interactions).

Assumption II - The codons are the basis vectors, in the crystal basis, of the irreducible representations build up by the tensor product of three 4-dimensional (12,12)1212({\textstyle{\frac{1}{2}}},{\textstyle{\frac{1}{2}}}) fundamental representations describing the nucleotides.
We have reported in Table 1 the assignment of the codons classified in the representations which appear in the r.h.s. of the following relation:

(12,12)(12,12)(12,12)=(32,32) 2(32,12) 2(12,32) 4(12,12)tensor-product121212121212direct-sum3232232122123241212({\textstyle{\frac{1}{2}}},{\textstyle{\frac{1}{2}}})\;\otimes\;({\textstyle{\frac{1}{2}}},{\textstyle{\frac{1}{2}}})\;\otimes\;({\textstyle{\frac{1}{2}}},{\textstyle{\frac{1}{2}}})\;=\;({\textstyle{\frac{3}{2}}},{\textstyle{\frac{3}{2}}})\;\oplus\;2\,({\textstyle{\frac{3}{2}}},{\textstyle{\frac{1}{2}}})\;\oplus\;2\,({\textstyle{\frac{1}{2}}},{\textstyle{\frac{3}{2}}})\;\oplus\;4\,({\textstyle{\frac{1}{2}}},{\textstyle{\frac{1}{2}}}) (7)

In [1], an operator (called the reading or ribosome operator) {\cal R} has been constructed out of the algebra 𝒰q0(sl(2)sl(2))subscript𝒰𝑞0direct-sum𝑠𝑙2𝑠𝑙2{\cal U}_{q\rightarrow 0}(sl(2)\oplus sl(2)), which describes the multiplet structure of the the genetic code in the following way: two codons have the same eigenvalue under {\cal R} if and only if they are associated to the same amino-acid. Moreover an “Hamiltonian” depending on 4 parameters has been build up which gives a very satisfactory fit of the 16 values of the free energy released in the folding of a RNA sequence into a base paired double helix.

Let us close this section by drawing the reader’s attention to Fig. 1 where is specified for each codon its position in the appropriate representation. The diagram of states for each representation is supposed to lie in a separate parallel plane. Thick lines connect codons associated to the same amino-acid. One remarks that each segment relates a couple of codons belonging to the same representation or to two different representations. This last case occurs for quadruplets or sextets of codons associated to the same amino-acid. It is the purpose of this letter to show a remarkable relation between such multiplets of codons (or amino-acids) involving the same subset of representation and (branching ratios of) the probabilities of presence of codons in the amino-acid biosynthesis.

3 Correlation of codon usage

We define the codon usage as the frequency of use of a given codon in the process of biosynthesis of all the amino-acids. We define the probability of usage of the codon XYZ𝑋𝑌𝑍XYZ of a given amino-acid as the ratio between the occurrence of the codon XYZ𝑋𝑌𝑍XYZ and the occurrence N𝑁N of the corresponding amino-acid, i.e. as the relative codon frequency, in the limit of very large N𝑁N. Here and in the following the labels X,Y,Z,V𝑋𝑌𝑍𝑉X,Y,Z,V represent the bases C,U,G,A𝐶𝑈𝐺𝐴C,U,G,A. The frequency rate of usage of a codon in a multiplet is connected to its probability of usage P(XYZa.a.)𝑃𝑋𝑌𝑍a.a.P(XYZ\rightarrow\mbox{a.a.}). It is reasonable to assume that P(XYZa.a.)𝑃𝑋𝑌𝑍a.a.P(XYZ\rightarrow\mbox{a.a.}) depends on: – the biological organism (b.o.) from which the sequence considered has been extracted
– the sequence analyzed
– the nature of the neighboring codons in the sequence
– the amino-acid (a.a.)
– the nature and structure of the multiplet associated to the amino-acid
– the biological environment
– the properties of the codon itself (XYZ𝑋𝑌𝑍XYZ).

We neglect the time in which the biosynthesis process takes place as we assume that the biosynthesis processes are considered at the same time, at least compared to the time scale of evolution of the genetic code. We define the branching ratio BZVsubscript𝐵𝑍𝑉B_{ZV} as

BZV=P(XYZa.a.)P(XYVa.a.)subscript𝐵𝑍𝑉𝑃𝑋𝑌𝑍a.a.𝑃𝑋𝑌𝑉a.a.B_{ZV}=\frac{P(XYZ\rightarrow\mbox{a.a.})}{P(XYV\rightarrow\mbox{a.a.})} (8)

We argue that in the limit of very large number of codons, for a fixed biological organism and amino-acid, the branching ratio depends essentially on the properties of the codon. In our model this means that in this limit BZVsubscript𝐵𝑍𝑉B_{ZV} is a function, depending on the type of the multiplet, on the quantum numbers of the codons XYZ𝑋𝑌𝑍XYZ and XYV𝑋𝑌𝑉XYV, i.e. on the labels Jα,Jα3subscript𝐽𝛼subscriptsuperscript𝐽3𝛼J_{\alpha},J^{3}_{\alpha} , where α=H𝛼𝐻\alpha=H or V𝑉V, and on an other set of quantum labels leaving out the degeneracy on Jαsubscript𝐽𝛼J_{\alpha}; in Table 1 different irreducible representations with the same values of Jαsubscript𝐽𝛼J_{\alpha} are distinguished by an upper label. Moreover we assume that BZVsubscript𝐵𝑍𝑉B_{ZV}, in the limit above specified, depends only on the irreducible representation (IR) of the codons, i.e.:

BZV=FZV(b.o.;IR(XYZ);IR(XYV))B_{ZV}=F_{ZV}(b.o.;IR(XYZ);IR(XYV)) (9)

Let us point out that the branching ratio has a meaning only if the codons XYZ𝑋𝑌𝑍XYZ and XYU𝑋𝑌𝑈XYU are in the same multiplet, i.e. if they code the same amino-acid.
We consider the quartets and sextets. There are five quartets and three sextets in the eukariotic code: that will allow a rather detailed analysis. Moreover the 3 sextets appear as the sum of a quartet and a doublet, see Table 1. In the following we consider only the quartet sub-part of the sextets. We recall that the 5 amino-acids coded by the quartets are: [Pro, Ala, Thr, Gly ,Val] and the 3 amino-acids coded by the sextets are: [Leu, Arg, Ser]. There are, for the quartets, 6 branching ratios, of which only 3 are independent. We choose as fundamental ones the ratios BAGsubscript𝐵𝐴𝐺B_{AG}, BCGsubscript𝐵𝐶𝐺B_{CG} and BUGsubscript𝐵𝑈𝐺B_{UG}. It happens that we can define several functions BZVsubscript𝐵𝑍𝑉B_{ZV}, considering ratios of probability of codons differing for the first two nucleotides XY𝑋𝑌XY, i.e.

BZVsubscript𝐵𝑍𝑉\displaystyle B_{ZV} =\displaystyle= FZV(b.o.;IR(XYZ);IR(XYV))\displaystyle F_{ZV}(b.o.;IR(XYZ);IR(XYV))
BZVsubscriptsuperscript𝐵𝑍𝑉\displaystyle B^{\prime}_{ZV} =\displaystyle= FZV(b.o.;IR(XYZ);IR(XYV))\displaystyle F_{ZV}(b.o.;IR(X^{\prime}Y^{\prime}Z);IR(X^{\prime}Y^{\prime}V)) (10)

Then if the codon XYZ𝑋𝑌𝑍XYZ (XYV𝑋𝑌𝑉XYV) and XYZsuperscript𝑋superscript𝑌𝑍X^{\prime}Y^{\prime}Z (XYVsuperscript𝑋superscript𝑌𝑉X^{\prime}Y^{\prime}V) are respectively in the same irreducible representation, it follows that

BZV=BZVsubscript𝐵𝑍𝑉subscriptsuperscript𝐵𝑍𝑉B_{ZV}=B^{\prime}_{ZV} (11)

The analysis was performed on a set of data retrieved from the data bank of “Codon usage tabulated from GenBank” [3]. In particular we analyzed two different data set: the first one comprises all the data of at least 2 000 codons, while the second set represents all the data with at least 30 000 codons. The referring organism for the analysis was Homo sapiens, whose codon usage table derives from the analysis of more than 12 500 coding sequences, and corresponds to about 6 000 000 codons.

Three quartets, coding the amino-acids Pro, Ala and Thr, have exactly the same content in irreducible representations, see Table 1. In Table 2 we report the 16 biological organisms with highest statistics. In Figs. 2, 3 and 4 the BAGsubscript𝐵𝐴𝐺B_{AG} , BUGsubscript𝐵𝑈𝐺B_{UG} and BCGsubscript𝐵𝐶𝐺B_{CG} are reported for the 8 amino-acids coded by the quartets and sextets showing:

  • a clear correlation between the four amino-acids Pro, Ala, Thr and Ser. From Table 1 we see that for these amino-acids the irreducible representation involved in the numerator of the branching ratios (see (8)) is always the same: (1/2,1/2)1superscript12121(1/2,1/2)^{1} for BAGsubscript𝐵𝐴𝐺B_{AG}, (1/2,3/2)1superscript12321(1/2,3/2)^{1} for BUGsubscript𝐵𝑈𝐺B_{UG}, (3/2,3/2)3232(3/2,3/2) for BCGsubscript𝐵𝐶𝐺B_{CG}, while the irreducible representation in the denominator is (1/2,1/2)1superscript12121(1/2,1/2)^{1} for the whole set. The relative position of each of these quartets of codons can be more easily visualized in Fig. 1 where Pro, Ala, Thr and Ser (quartet part) constitute the four edges of a vertical column linking the representation (1/2,1/2)1superscript12121(1/2,1/2)^{1}, sitting at the ground floor, first to the representation (3/2,1/2)1superscript32121(3/2,1/2)^{1}, then to the (1/2,3/2)1superscript12321(1/2,3/2)^{1} one and finally to the representation (3/2,3/2)3232(3/2,3/2), this last one located at the top floor.

  • a clear correlation between the two amino-acids Val and Leu. From Table 1 we see that also for these two amino-acids the irreducible representation in the numerator of (8) is the same: (1/2,1/2)3superscript12123(1/2,1/2)^{3} for BAGsubscript𝐵𝐴𝐺B_{AG}, (1/2,3/2)2superscript12322(1/2,3/2)^{2} for BUGsubscript𝐵𝑈𝐺B_{UG}, (1/2,3/2)2superscript12322(1/2,3/2)^{2} for BCGsubscript𝐵𝐶𝐺B_{CG}, and the irreducible representation in the denominator is (1/2,1/2)3superscript12123(1/2,1/2)^{3}. Considering Fig. 1, it is now the two representations (1/2,1/2)3superscript12123(1/2,1/2)^{3} and (1/2,3/2)2superscript12322(1/2,3/2)^{2} which are brought together, the codons associated to Val and Leu (quartet part) determining the vertices of two parallel and vertical plaquettes.

  • no correlation of the Arg and also of the Gly with the others amino-acids, in agreement with the irreducible representation assignment of Table 1. Indeed we can note in Fig. 1 that the representations (1/2,1/2)2superscript12122(1/2,1/2)^{2} and (3/2,1/2)2superscript32122(3/2,1/2)^{2} are connected by the codon quartet relative to Arg and (but) only by this multiplet. We also remark the Gly quartet in the representations (1/2,3/2)1superscript12321(1/2,3/2)^{1} and (3/2,3/2)3232(3/2,3/2): its position is completely different from the above discussed quartets which show up in these representations.

Then in Figs. 5, 6 and 7 we have drawn the normalized branching ratios B^PGsubscript^𝐵𝑃𝐺\widehat{B}_{PG}, P{A,U,C}𝑃𝐴𝑈𝐶P\in\{A,U,C\}, defined by:

B^PG=BPGa.a.BAGsubscript^𝐵𝑃𝐺subscript𝐵𝑃𝐺subscriptformulae-sequence𝑎𝑎subscript𝐵𝐴𝐺\widehat{B}_{PG}=\frac{B_{PG}}{\sum_{a.a.}\,B_{AG}} (12)

where the sum a.a.subscriptformulae-sequence𝑎𝑎\sum_{a.a.} is extended to the eight amino-acids above listed. The mean value and the standard deviation are:

Pro Ala Thr Ser Val Leu Arg Gly
B^AGdelimited-⟨⟩subscript^𝐵𝐴𝐺\langle\widehat{B}_{AG}\rangle 1.60 1.46 1.57 1.61 0.16 0.11 0.50 1.00
σ(B^AG)𝜎subscript^𝐵𝐴𝐺\sigma(\widehat{B}_{AG}) 0.16 0.16 0.17 0.21 0.03 0.02 0.15 0.29
B^CGdelimited-⟨⟩subscript^𝐵𝐶𝐺\langle\widehat{B}_{CG}\rangle 1.24 1.66 1.46 1.83 0.26 0.23 0.60 0.73
σ(B^CG)𝜎subscript^𝐵𝐶𝐺\sigma(\widehat{B}_{CG}) 0.15 0.18 0.15 0.23 0.05 0.04 0.16 0.18
B^UGdelimited-⟨⟩subscript^𝐵𝑈𝐺\langle\widehat{B}_{UG}\rangle 1.49 1.71 1.24 2.07 0.25 0.19 0.45 0.60
σ(B^UG)𝜎subscript^𝐵𝑈𝐺\sigma(\widehat{B}_{UG}) 0.26 0.13 0.14 0.32 0.06 0.04 0.22 0.22

These diagrams show an universal behaviour of B^PGsubscript^𝐵𝑃𝐺\widehat{B}_{PG} which has the same value independently of the biological organism. We have omitted in the diagram the branching ratio of the amino-acid Gly as it is dependent from the branching ratios of the other amino-acids due to our definition eq. (12). In our model this behaviour can easily be understood if the branching ratio BZVsubscript𝐵𝑍𝑉B_{ZV} has the factorized form

BZV=ΦZV(b.o.)ψZV(IR(XYZ);IR(XYV))B_{ZV}=\Phi_{ZV}(b.o.)\,\psi_{ZV}(IR(XYZ);IR(XYV)) (13)

This factorization explains also the correlation in the behaviour between the values of BPGsubscript𝐵𝑃𝐺B_{PG} for different biological organisms, see Figs. 2, 3 and 4. Finally we report in the table below the mean value and the standard deviation for the case of biological organisms with low statistics to put in evidence the effects of the statistics.

Pro Ala Thr Ser Val Leu Arg Gly
B^AGdelimited-⟨⟩subscript^𝐵𝐴𝐺\langle\widehat{B}_{AG}\rangle 1.77 1.49 1.67 1.13 0.17 0.15 0.61 1.01
σ(B^AG)𝜎subscript^𝐵𝐴𝐺\sigma(\widehat{B}_{AG}) 0.67 0.40 0.49 0.56 0.09 0.18 0.34 0.44
B^CGdelimited-⟨⟩subscript^𝐵𝐶𝐺\langle\widehat{B}_{CG}\rangle 1.29 1.55 1.52 1.82 0.25 0.23 0.62 0.71
σ(B^CG)𝜎subscript^𝐵𝐶𝐺\sigma(\widehat{B}_{CG}) 0.47 0.39 0.41 0.53 0.08 0.08 0.32 0.32
B^UGdelimited-⟨⟩subscript^𝐵𝑈𝐺\langle\widehat{B}_{UG}\rangle 1.50 1.61 1.26 2.09 0.25 0.19 0.51 0.60
σ(B^UG)𝜎subscript^𝐵𝑈𝐺\sigma(\widehat{B}_{UG}) 0.58 0.39 0.39 0.64 0.10 0.09 0.28 0.32

4 Conclusions

The basic elements of our model of the genetic code are the 4 nucleotides and the 64 codons come out as composed states. The symmetry algebra 𝒰q0(sl(2)sl(2))subscript𝒰𝑞0direct-sum𝑠𝑙2𝑠𝑙2{\cal U}_{q\rightarrow 0}(sl(2)\oplus sl(2)) has two main characteristics. Firstly, it encodes the stereochemical property of a base confering quantum numbers to each nucleotide. Secondly, it admits representation spaces with the remarkable property that the vector bases of the tensor product are ordered sequences of the basic elements (nucleotides). The model does not necessarily assign the codons in a multiplet (in particular the quartets, sextets and triplet) to the same irreducible representation. This feature is relevant. Indeed, as we have shown in this paper, it may explain the correlation between the branching ratio of the codon usage of different codons coding the same amino-acid. Let us remark that the assignments of the codons to the different irreducible representations is a straightforward consequence of the tensor product once assigned the nucleotides to the fundamental irreducible representation, see our first assumption.

It is a prevision of our model that for any biological organism belonging to the vertebrate series, in the limit of large number of biosynthetized amino-acids, the ratios BAGsubscript𝐵𝐴𝐺B_{AG}, BUGsubscript𝐵𝑈𝐺B_{UG} and BCGsubscript𝐵𝐶𝐺B_{CG} for, respectively, Pro, Ala, Thr and Ser (Val and Leu) should be very close. Let us remark that obviously these ratios depend on the biological organism and we are unable to make any prevision on their values, but only that their values should be correlated. Our analysis has also shown an universal behaviour of the normalized branching ratio of the codon usage for the vertebrates, which was not evidently expected in our model, but which can easily be explained assuming a factorized form for the BZVsubscript𝐵𝑍𝑉B_{ZV}. So, assuming the factorization (13), we foresee that the normalized ratio B^AGsubscript^𝐵𝐴𝐺\widehat{B}_{AG}, B^UGsubscript^𝐵𝑈𝐺\widehat{B}_{UG} and B^CGsubscript^𝐵𝐶𝐺\widehat{B}_{CG} should be given for any biological organism by the values reported in Figs. 5, 6 and 7.

A first analysis including biological organisms belonging to the invertebrate and plant series show that the pattern of correlation is still present, even in a less striking way, but significant deviations appear for some biological organisms. A more detailed analysis with extension to the other multiplets, in particular the doublets, and to other series of biological organisms will be done in a further more detailed publication.


Acknowledgments We are deeply indebted with Maria Luisa Chiusano for providing us the data which have allowed the analysis presented in this work and for very useful discussions. It is also a pleasure to thank J.C. Le Guillou for discussions and encouragements.

References

  • [1] L. Frappat, A. Sciarrino, P. Sorba, A crystal basis for the genetic code, Preprint ENSLAPP-AL-671/97 and DSF-97/37, physics/9801027, to appear in Phys. Lett. A.
  • [2] M. Kashiwara, Commun. Math. Phys. 133 (1990) 249.
  • [3] Y. Nakamura, T. Gojobori, and T. Ikemura, Nucleic Acids Research 26 (1998) 334.
Figure 1: Classification of the codons in the different crystal bases.
CCCUCCUUCUUUGCCACCAUCAUUGGCAGCAACAAUGGGAGGAAGAAACCUUCUGCUACUGGUAGUGGAAGACCGUCGUUGUUAGCGACGAUGAUACCAUCAGCAACAGlySer2Arg2PheIleAsnLysProAlaSer4ThrLeu2(3/2,3/2)3232(3/2,3/2)(1/2,3/2)1superscript12321(1/2,3/2)^{1}(3/2,1/2)1superscript32121(3/2,1/2)^{1}(1/2,1/2)1superscript12121(1/2,1/2)^{1}

Figure 1 (cont’d)

CUCCUUGUCGUUGACGAUGAGGAACUGCUAGUGGUALeu4ValAspGluCGCUGCUACUAUCGGUGGUAGUAACGUUGUCGAUGAArg4CysTyrTerTrpCACCAUCAGCAAHisGln(1/2,3/2)2superscript12322(1/2,3/2)^{2}(1/2,1/2)3superscript12123(1/2,1/2)^{3}(3/2,1/2)2superscript32122(3/2,1/2)^{2}(1/2,1/2)2superscript12122(1/2,1/2)^{2}(1/2,1/2)4superscript12124(1/2,1/2)^{4}
Figure 2: Branching ratio BAGsubscript𝐵𝐴𝐺B_{AG} for the vertebrate series.
Refer to caption
Figure 3: Branching ratio BCGsubscript𝐵𝐶𝐺B_{CG} for the vertebrate series.
Refer to caption
Figure 4: Branching ratio BUGsubscript𝐵𝑈𝐺B_{UG} for the vertebrate series.
Refer to caption
Figure 5: Normalized branching ratio BAGsubscript𝐵𝐴𝐺B_{AG} for the vertebrate series.
Refer to caption
Figure 6: Normalized branching ratio BCGsubscript𝐵𝐶𝐺B_{CG} for the vertebrate series.
Refer to caption
Figure 7: Normalized branching ratio BUGsubscript𝐵𝑈𝐺B_{UG} for the vertebrate series.
Refer to caption
Table 1: The eukariotic code. The upper label denotes different IR.
codon a.a. JHsubscript𝐽𝐻J_{H} JVsubscript𝐽𝑉J_{V} codon a.a. JHsubscript𝐽𝐻J_{H} JVsubscript𝐽𝑉J_{V}
CCC Pro 3/2 3/2 UCC Ser 3/2 3/2
CCU Pro (1/2 3/2)1)^{1} UCU Ser (1/2 3/2)1)^{1}
CCG Pro (3/2 1/2)1)^{1} UCG Ser (3/2 1/2)1)^{1}
CCA Pro (1/2 1/2)1)^{1} UCA Ser (1/2 1/2)1)^{1}
CUC Leu (1/2 3/2)2)^{2} UUC Phe 3/2 3/2
CUU Leu (1/2 3/2)2)^{2} UUU Phe 3/2 3/2
CUG Leu (1/2 1/2)3)^{3} UUG Leu (3/2 1/2)1)^{1}
CUA Leu (1/2 1/2)3)^{3} UUA Leu (3/2 1/2)1)^{1}
CGC Arg (3/2 1/2)2)^{2} UGC Cys (3/2 1/2)2)^{2}
CGU Arg (1/2 1/2)2)^{2} UGU Cys (1/2 1/2)2)^{2}
CGG Arg (3/2 1/2)2)^{2} UGG Trp (3/2 1/2)2)^{2}
CGA Arg (1/2 1/2)2)^{2} UGA Ter (1/2 1/2)2)^{2}
CAC His (1/2 1/2)4)^{4} UAC Tyr (3/2 1/2)2)^{2}
CAU His (1/2 1/2)4)^{4} UAU Tyr (3/2 1/2)2)^{2}
CAG Gln (1/2 1/2)4)^{4} UAG Ter (3/2 1/2)2)^{2}
CAA Gln (1/2 1/2)4)^{4} UAA Ter (3/2 1/2)2)^{2}
GCC Ala 3/2 3/2 ACC Thr 3/2 3/2
GCU Ala (1/2 3/2)1)^{1} ACU Thr (1/2 3/2)1)^{1}
GCG Ala (3/2 1/2)1)^{1} ACG Thr (3/2 1/2)1)^{1}
GCA Ala (1/2 1/2)1)^{1} ACA Thr (1/2 1/2)1)^{1}
GUC Val (1/2 3/2)2)^{2} AUC Ile 3/2 3/2
GUU Val (1/2 3/2)2)^{2} AUU Ile 3/2 3/2
GUG Val (1/2 1/2)3)^{3} AUG Met (3/2 1/2)1)^{1}
GUA Val (1/2 1/2)3)^{3} AUA Ile (3/2 1/2)1)^{1}
GGC Gly 3/2 3/2 AGC Ser 3/2 3/2
GGU Gly (1/2 3/2)1)^{1} AGU Ser (1/2 3/2)1)^{1}
GGG Gly 3/2 3/2 AGG Arg 3/2 3/2
GGA Gly (1/2 3/2)1)^{1} AGA Arg (1/2 3/2)1)^{1}
GAC Asp (1/2 3/2)2)^{2} AAC Asn 3/2 3/2
GAU Asp (1/2 3/2)2)^{2} AAU Asn 3/2 3/2
GAG Glu (1/2 3/2)2)^{2} AAG Lys 3/2 3/2
GAA Glu (1/2 3/2)2)^{2} AAA Lys 3/2 3/2
Table 2: Biological organisms with highest statistics.
Biological organism number of sequences number of codons
1 Homo sapiens 12 512 ——– 6 130 940 —–
2 Gallus gallus 1 319 ——– 638 532 —–
3 Xenopus laevis 1 144 ——– 493 437 —–
4 Bos taurus 1 182 ——– 478 270 —–
5 Oryctolagus cuniculus 639 ——– 321 129 —–
6 Sus scrofa 539 ——– 216 654 —–
7 Danio rerio 259 ——– 99 766 —–
8 Canis familiaris 230 ——– 94 444 —–
9 Ovis aries 275 ——– 81 177 —–
10 Oncorhynchus mykiss 128 ——– 42 794 —–
11 Macaca mulatta 110 ——– 34 510 —–
12 Fugu rubripes 63 ——– 32 943 —–
13 Cyprinus carpio 95 ——– 32 365 —–
14 Equus caballus 94 ——– 31 254 —–
15 Rana cates beiana 61 ——– 30 629 —–
16 Felis catus 83 ——– 30 031 —–