First experimental tests of the Peyrard-Bishop model applied to the melting of very short DNAs

Abstract

The melting curves of short heterogeneous DNA chains in solution are calculated on the basis of statistical thermodynamics and compared to experiments. The computation of the partition function is based on the Peyrard-Bishop hamiltonian, which has already been adopted in the theoretical description of the melting of long DNA chains. In the case of short chains it is necessary to consider not only the breaking of the hydrogen bonds between single base pairs, but also the complete dissociation of the two strands forming the double helix.

There is a need for a theory of the melting of short DNA chains (oligonucleotides). The melting is the highly cooperative thermal disruption of the hydrogen bonds between complementary bases in the double helix, as usually monitored by the UV absorption increment due to the unstacking of the separated bases [1]. At the equilibrium melting temperature half of the bonds are disrupted. Synthetic oligonucleotides of a fixed length and base pairs sequence have been used for a long time as model systems for the study of the structural and thermodynamical properties of the longer and more complex natural forms of DNA [2]. Many studies have shown the effects of both sequence and solvent composition on the melting curves of oligonucleotides in solution [3]. More recently particular attention has been given to the study of sequence specific effects on the thermal stability of a variety of specially designed oligonucleotides, due to their importance in the exploitation of molecular biological techniques in gene therapy [4] and genome mapping [5]. Predictive information has been gained through an extensive thermodynamical investigation on the melting behavior of oligonucleotides, based on the computation of the Gibbs free energy, at a fixed solvent composition, as a sum of contributions from nearest neighbors in the sequences [6, 7]. This phenomenology and the predictive power of the thermodynamical approach should then be confronted with a microscopic theory of short, heterogeneous DNA chains.

Modellization of DNA melting was initially motivated by the study of the important process of transcription, in which the double helix has to be locally opened to allow reading of the genetic code. It was based, already many years ago, on Ising-like models [8, 9], and more recently on an approach based on the modified self-consistent phonon approximation [10] (see also [11] and references therein). These methods allow only equilibrium estimates of the probability of bond disruption. However, it is also important to consider DNA dynamics, both at melting and pre-melting temperatures. There is an interest in relaxation and kinetic phenomena, which are relevant for the pharmacological applications [4], and in the study of nonlinear energy localization and transduction. With a particular focus on the last problem, discrete nonlinear models of DNA (see, e. g., [12, 13], and for a review [14]), have been introduced; sequence effects have been considered in [15]. These models are appealing, because they are simplified microscopic models with a small number of degrees of freedom, and thus are affordable also for the simulation of very long times. The experimentally available melting curves offer a way to optimize the parameters of these models, and therefore also increase the confidence for their use in dynamical studies.

With a particular interest in thermal stability, a dynamical model was introduced by Peyrard and Bishop in 1989 [16] (PB model). The authors have shown, through statistical mechanics calculations and constant temperature molecular dynamics [16, 17, 18], applied to the case of a very long homogeneous DNA chain, that the model can give a satisfactory melting curve, especially after the improvement introduced in [18]. The PB model has been successively applied to heterogeneous chains, either modelling the heterogeneity with a quenched disorder [19], or properly choosing basis sets of orthonormal functions for the kernels appearing in the expression of the partition function [20], but comparison with experimental data was not attempted. In all these works the fact that the DNAs considered are quite long was essential, for the following reason. In a solution with two types of DNA single strands, $A$ and $B$, there is a thermal equilibrium between dissociated strands and associated double strands (the duplexes $AB$), and a thermal equilibrium, in the duplexes, between broken and unbroken interbase hydrogen bonds. The average fraction $\theta$ of bonded base pairs can then be factorized as $\theta=\theta_{ext}\theta_{int}$ [8, 9]. $\theta_{ext}$ is the average fraction of strands forming duplexes, while $\theta_{int}$ is the average fraction of unbroken bonds in the duplexes. The dissociation equilibrium can be neglected in the case of long chains, where $\theta_{int}$ and thus $\theta$ go to 0 when $\theta_{ext}$ is still practically 1. On the contrary, in the case of short chains the processes of single bond disruption and strand dissociation tend to happen in the same temperature range; therefore, the computation of both $\theta_{int}$ and $\theta_{ext}$ is essential. In Ref. [20] the factorization of $\theta$ is stated, but only the case of long chains is then considered.

The aim of this work is to show, through a comparison with experimental data, that the onedimensional PB model can be used to compute the melting curves of short DNAs. It will also be shown how to take into account the dissociation equilibrium.

The potential of the PB model [16, 17, 18] is given by:

$$U=\sum_{i}\Bigl{\{}\frac{k}{2}\left[1+\rho e^{-\alpha(y_{i+1}+y_{i})}\right]{(y_{i+1}-y_{i})}^{2}+D_{i}{\left(e^{-a_{i}y_{i}}-1\right)}^{2}\Bigr{\}},$$ (1)

where $y_{i}$ is the distance between the $i$-th complementary bases minus their equilibrium separation. The parameters $k$, $\rho$ and $\alpha$ refer to the anharmonic stacking interaction, while the interbase bond is represented by a Morse potential, with depth $D_{i}$ and width $a_{i}$. In Refs. [16, 17, 18] there is only a single parameter $D$ because only homogeneous DNAs have been considered. The stacking interaction, that in the first attempts [16, 17] was purely harmonic ($\rho=0$), decreases when the complementary bases get farther ($\rho$ positive): this $\rho$ dependent nonlinear term was found to be relevant to give cooperativity to the melting process [18].

To model heterogeneous DNAs, we have inserted two different values of $D_{i}$, according to the two possible Watson-Crick base pairs: adenine-thymine (A-T) and guanine-cytosine (G-C). The former has two hydrogen bonds, while the latter has three. We have then chosen a depth for the G-C Morse potential 1.5 times that for the A-T Morse potential. The complete set of parameter values that we have chosen is : $k=0.025$ eV/Ų, $\rho=2$, $\alpha=0.35$ Å^-1, $D_{AT}=0.05$ eV, $D_{GC}=0.075$ eV, $a_{AT}=4.2$ Å^-1, $a_{GC}=6.9$ Å^-1. These values have been adjusted to reproduce the experimentally observed melting temperature of long homogeneous DNA in the most usual solvent conditions [9, 21]. For a given set of values, the melting temperatures can be deduced with the technique of the transfer matrix method [16, 17, 18].

We have then made a statistical mechanics computation, in which partition functions have been used to obtain both $\theta_{int}$ and $\theta_{ext}$. For the computation of $\theta_{int}$ one has to separate the configurations describing a double strand on the one hand, and dissociated single strands on the other. The very possibility of dissociation makes this a non trivial problem. We have adopted the following strategy. The $i$-th bond is considered disrupted if the value of $y_{i}$ is larger than a chosen threshold $y_{0}$. We have therefore defined a configuration to belong to the double strand if at least one of the $y_{i}$s is smaller than $y_{0}$. It is then natural to define $\theta_{int}$ for an $N$ base pair duplex by:

$$\theta_{int}=\frac{1}{N}\sum_{i=1}^{N}<\vartheta(y_{0}-y_{i})>$$

where $\vartheta(y)$ is the Heaviside step function and the canonical average $<\cdot>$ is defined considering only the double strand configurations. We have chosen a value of 2 Å for $y_{0}$. After a discretization of the coordinate variables and the introduction of a proper cutoff on the maximum value of the $y_{i}$s [10], the computations needed for the canonical averages are readily reduced to the multiplication of finite matrices, since the potential (1) couples only nearest neighbors, and are easily performed by suitable computer programs.

Let us now consider $\theta_{ext}$. At equilibrium the chemical potentials of the three species $A$, $B$ and $AB$ [22] are related by the equation: $\mu_{AB}-\mu_{A}-\mu_{B}=0$. Using the definition of the chemical potentials as derivatives of the free energy, and in turn the relation of the latter to the partition functions, we obtain an equation involving appropriate partition functions. In the usual experimental conditions the solutions can be considered ideal; with the further assumption that the model takes into account effectively the presence of the solvent, we get the usual equilibrium condition:

$$\frac{N_{AB}Z(A)Z(B)}{N_{A}N_{B}Z(AB)}=1$$

where $N_{j}$ is the number of molecules of species $j$ in the volume $V$ considered, and $Z(j)$ is the partition function of a molecule of species $j$ in V [23]. The numbers $N_{j}$ are related by the constraints $2N_{AB}+N_{A}+N_{B}=const\equiv 2N_{0}$ and $\Delta N_{A}=\Delta N_{B}=-\Delta N_{AB}$. Considering the case $N_{A}=N_{B}$ (the experimental curves that we are presenting are made in these conditions, with the duplex obtained by annealing equal concentrations of $A$ and $B$), we arrive at the following expression for $\theta_{ext}\equiv N_{AB}/N_{0}$:

$$\theta_{ext}=1+\delta-\sqrt{\delta^{2}+2\delta}$$

where $\delta$ is given by the following expression:

$$\delta=\frac{Z(A)Z(B)}{2N_{0}Z(AB)}\equiv\frac{Z_{int}(A)Z_{int}(B)}{a_{av}Z_{int}(AB)}\frac{a_{av}Z_{ext}(A)Z_{ext}(B)}{2N_{0}Z_{ext}(AB)},$$ (2)

where in the rightmost side we have introduced the separation of the partition functions in an internal and an external part [8, 9]; the meaning of $a_{av}$ will be explained in a moment. For the calculation of the internal functions, that do not include the overall translation of the molecules, we use the DNA model described above (which is also simply adapted to the description of single strands, allowing an analytical evaluation: only a harmonic stacking interaction remains, which is weaker than in the duplex, since in this case the term involving $\rho$ is 0). We have chosen to insert in the last side of Eq. (2) $a_{av}=\sqrt{a_{AT}a_{GC}}$ to make separately dimensionless both fractions, that therefore can not depend on the choice of units. Without any such normalization the first fraction would have the dimensions of an inverse of a length, since the overall translation is not included in $Z_{int}$. It is included in the external functions, that, however, have to take into account also the dynamics not described by the simple onedimensional model, and related to conformational movements (like, for example, the winding of the strands). This point has already been considered in Ising models: the influence on the dissociation process of the degrees of freedom not described by the model can not be neglected, and it must be accounted for in some way. In analogy to what has been proposed for the Ising models [8, 9] on the basis of the partition functions of rigid bodies [24], we make the following choice:

$$\frac{a_{av}Z_{ext}(A)Z_{ext}(B)}{2N_{0}Z_{ext}(AB)}=\frac{n^{*}}{n_{0}}N^{-p\theta_{int}+q}$$ (3)

where the parameters $p$ and $q$ can be fixed by a comparison with experimental melting curves; $n_{0}$ is the single strand concentration $N_{0}/V$, and $n^{*}$ is a chosen reference concentration (we have taken 1 $\mu$M, a usual concentration in experiments). We defer further comments about this equation after the presentation of the results.

We show here the comparison of our calculations with the experimental melting curves that have been obtained, in our lab, for three different oligonucleotides, in a 10mM Na phosphate buffer, 0.1 mM Na₂EDTA, 200 mM NaCl, pH 6.7. One of the oligonucleotides contained 27 base pairs, and the other two had 21 base pairs. The sequences are given by:

$$s_{1}) \,\,{\rm{}^{5^{\prime}}CTTCTTATTCTTATTGTTCGTCTTCTC_{3^{\prime}}}$$

$$s_{2}) \,\,{\rm{}^{5^{\prime}}CTCTTCTCTTCTTTCTCTCTC_{3^{\prime}}}$$

$$s_{3}) \,\,{\rm{}^{5^{\prime}}GTGTTAACGTGAGTATAGCGT_{3^{\prime}}}$$

and by the respective complementary strands. We have considered the case $s_{3})$ at two different concentrations. The single strand concentration was: $s_{1})$: 2.4 $\mu$M, $s_{2})$: 1.7 $\mu$M, $s_{3})$: 3.1 $\mu$M and 120 $\mu$M. In Fig. 1 we show the experimental and computed melting curves. As it can be seen, there are sequence and concentration effects on the experimental melting curves, which are well reproduced by the computed curves. Note that a 40 fold concentration increase for $s_{3})$ yields an increase of only 5 degrees in the melting temperature (a logarithmic dependence on the concentration is expected [1]). Similar differences between curves at the low concentrations should then be due to sequence and length effects. We would like to stress that in the case $s_{3})$ the parameters $p$ and $q$ have been fitted to the experimental curve at the lower concentration. The comparison with the experimental curve at the higher concentration has then been performed with only the change of the value of $n_{0}$ in Eq. (3), without changing the values of $p$ and $q$; this has reproduced the difference between the melting temperatures of the two cases, that differ by about 5 degrees. This fact indicates that the concentration dependence of the left hand side of Eq. (3) is described by the preexponential factor, while the parameters $p$ and $q$ are related to the molecular conformation.

In conclusion, our comparisons show that it is feasible to compute the equilibrium melting profile of DNA oligonucleotides with the PB nonlinear model. We would also like to note that the modellization of the external partition functions ratio as in Eq. (3) is very similar to that adopted in Ising models for medium size DNAs (100-600 base pairs) [8, 9]. This confirms that this term is related to the conformational flexibility of the double and single strands, not described by a onedimensional model. The internal term is related to the onedimensional hamiltonian and then to nearest neighbor interactions. For long DNAs (large $N$), at temperatures in which $\theta_{int}$ is already close to 0, the part in Eq. (2) depending on the internal partition functions goes as $e^{-\gamma N}$ for some positive $\gamma$, and thus $\delta\approx 0$ and $\theta_{ext}\approx 1$. This $N$ dependence of the internal part can be seen, for example, in the case of homogeneous sequences with the transfer matrix method [16, 17, 18]. It is expected to be the same for heterogeneous sequences.

Figure 1: Experimental melting profiles (full lines) and theoretical results (dashed lines) for the three DNA chains. We have plotted the value of $\phi\equiv 1-\theta$. Panel a): sequence $s_{1}$; panel b): sequence $s_{2}$; panel c): sequence $s_{3}$ at the lower concentration; panel d): sequence $s_{3}$ at the higher concentration. The fitted parameters $p$ and $q$ have the following values: $p=32.43$ and $q=29.30$ for $s_{1}$; $p=36.77$ and $q=34.89$ for $s_{2}$; $p=29.49$ and $q=27.69$ for $s_{3}$.

In very short chains like ours, it is not surprising that the specific sequence has some influence on the parameters $p$ and $q$, while in medium chains some self-averaging effects should already take place. In fact, as shown in the caption to Fig. 1, we have found differences of about 25 percent in the parameters referring to different sequences. We are now working on a more extended set of melting curves for a properly chosen set of oligonucleotides, that can help in the attempt to find the relation between the specific sequence and the optimized parameters. Then it would be possible to test the predictive power of this model and confront it with the predictions of purely thermodynamical calculations.

In a more extended paper in preparation we will show a more exhaustive comparison with experimental curves. We will also check if a simple analysis based on the number of occurrences of the different intrastrand nearest neighbor couples in the sequences is sufficient to obtain the parameters, similarly to what happens in the calculations of Gibbs free energy in short oligonucleotides [6, 7].

We are very grateful to F. Barone, M. Matzeu, F. Mazzei and F. Pedone for providing the experimental melting curves and for illuminating discussions.