Abstract

The Chapter starts with introductory information about quantitative linguistics notions, like rank–frequency dependence, Zipf’s law, frequency spectra, etc. Similarities in distributions of words in texts with level occupation in quantum ensembles hint at a superficial analogy with statistical physics. This enables one to define various parameters for texts based on this physical analogy, including “temperature”, “chemical potential”, entropy, and some others. Such parameters provide a set of variables to classify texts serving as an example of complex systems. Moreover, texts are perhaps the easiest complex systems to collect and analyze.

Similar approaches can be developed to study, for instance, genomes due to well-known linguistic analogies. We consider a couple of approaches to define nucleotide sequences in mitochondrial DNAs and viral RNAs and demonstrate their possible application as an auxiliary tool for comparative analysis of genomes.

Finally, we discuss entropy as one of the parameters, which can be easily computed from rank–frequency dependences. Being a discriminating parameter in some problems of classification of complex systems, entropy can be given a proper interpretation only in a limited class of problems. Its overall role and significance remain an open issue so far.

Chapter 0 Approaches to the Classification of Complex Systems: Words, Texts, and More

\body

1 Introduction

[Uncaptioned image]

Gabriel Altmann
   (24.05.1931 – 02.03.2020)

Source: Altmann’s homepage

Approaches originating in natural sciences, physics in particular, have proven useful in other domains, including social sciences and humanities. Active development started in the 1990s[1], however, sporadic earlier works can be found as well [2, 3, 4, 5, 6].

The major part of this Chapter will focus on studies of texts as examples of complex systems. Before proceeding, it is thus worth mentioning a kind of warning once issued by Gabriel Altmann, a leading expert in quantitative linguistics [7]:

As a matter of fact, the greatest problem is the undifferentiated identification of physical and linguistic entities… One should not try to transfer the gravitation theory to dialectology (once made by a linguist!) or the complete thermodynamics to a linguistic discipline only because the concept of entropy is applicable both in physics and linguistics. Thus, if there is some analogy between physical and linguistic entities… there must exist a way to find it without reductionist attempts and respecting the thinghood of physical and linguistic entities. The only possibility is to take into account the properties of models, i.e. to scrutinize the common abstract super-systems – if there are any.

In what follows in this Chapter, I will try adhering to this caveat as much as possible. Sometimes, however, it would be too tempting to avoid such a step while analyzing complex systems [8, 9, 10, 11]. Mathematical models and certain notions will be essentially borrowed from statistical physics and applied to objects and notions from beyond physics providing thus potentially new insights in these fields. This is possible due to the fact that non-random systems of many entities are characterized by certain distributions. A general feature of this study is that some quantities being analogs of, e. g., temperature or entropy that are standard concepts in thermodynamics, can linked to those distributions in a way analogous to approaches of statistical mechanics.

The organization of the reminder of this Chapter is as follows. Upon finishing this Section with explanation of certain notions used throughout the text, I proceed with models used to describe rank–frequency dependences in \srefsec:rf_models. The notion of “temperature” in linguistics is discussed in \srefsec:Temp followed by argumentation toward its scaling in \srefsec:Tscaling. Linguistics analogies in genomic studies are described in \srefsec:Genomes. Results related to “temperature” are presented in \srefsec:T-res for two different problems. Section 7 addresses the notion of entropy and some other parameters with a potential use in the classification of complex systems, as demonstrated in \srefsec:S-res for two separate problems. Brief discussion in \srefsec:Final concludes the Chapter.


Let us start with some central notions used further. Consider the beginning of the famous Prince Hamlet’s soliloquy,

To be, or not to be, that is the question
(1) (2) (3) (4) (5) (6) (7) (8) (9)     (10)

Here, we have ten tokens (words) and eight types (different words) since tokens (1) and (5) as well as (2) and (6) are identical. Note that one can also apply the so called lemmatization, i. e., reducing words to their basic (dictionary) form called lemma. This lowers the number of types: token (8) ‘is’ lemmatizes as ‘[to] be’. With this example we also see that, depending on the approach used, lemmatization can also lower the number of tokens: one can treat (1)–(2) as two tokens or as a single ‘to_be’. Obviously, the things become even more complicated if several languages are considered. To avoid such unnecessary discussions, only non-lemmatized texts are analyzed hereafter. To be specific, the so called orthographic words are considered in this Chapter: texts are stripped of punctuation marks and alphanumeric sequences between two spaces are counted (the beginning and end of the line are treated as spaces). In case of bicameral scripts (those distinguishing upper- and lowercase letters, i. e., Roman, Cyrillic, Greek, and a few others), no case distinction is made. The total number of tokens will be denoted N𝑁N while the total number of types will be V𝑉V.

Frequency lists are compiled in the form of pairs

<token>ifi,subscriptexpectationtoken𝑖subscript𝑓𝑖<\!\textrm{token}\!>_{i}\quad f_{i},

where fisubscript𝑓𝑖f_{i} is the number of occurrences (absolute frequency, hence the notation) of <token>isubscriptexpectationtoken𝑖<\!\!\textrm{token}\!\!>_{i} in the given sample. Upon a descending sort of the list by the values of numbers {fi}subscript𝑓𝑖\{f_{i}\} (largest to smallest) we obtain the rank–frequency dependence frsubscript𝑓𝑟f_{r}: the highest number corresponds to rank r=1𝑟1r=1, the second highest one has rank r=2𝑟2r=2 and so on. Tokens with equal frequencies occupy just a consecutive range of the respective ranks, cf. [12, p. 13], [13, p. 806] or [14, p. 10]. Such an approach is known as ordinal ranking, as opposed to the so called fractional or tied ranking, when a single value of the rank is assigned to such items, usually the mean of the rank range, though this is not a single possible option [15].

Inverting—in a certain sense—a rank–frequency dependence, one gets a frequency spectrum. The resulting set of quantities Njsubscript𝑁𝑗N_{j} corresponds to the number or types having absolute frequency exactly equal to j𝑗j.

2 Rank–frequency dependence models

Figure 1 demonstrates some typical rank–frequency dependences compiled from texts of Lewis Carroll’s Alice’s Adventures in Wonderland in three languages. Long plateaus at the lowermost absolute frequencies fr=1,2subscript𝑓𝑟12f_{r}=1,2, etc. mean a large number of the respective tokens. They are often referred to by special terms: tokens occurring only once in a sample are known as hapax legomena (often just shortened to hapaxes) and those occurring twice are dis legomena. These are plurals of the respective Classical Greek terms ἅπαξ / δίς λεγ´ομενον ‘[something] said [only] once / twice’. Subsequent terminology is straightforward but it will not be used here.

Refer to caption

Figure 1: Rank–frequency dependences for Alice’s Adventures in Wonderland in English, Hawaian, and Ukrainian (own results). The relevant studies based in particular on this text were reported in Ref. 16, 17

It is likely[18] that an (approximate) inverse proportionality between word’s frequency and its rank was first observed in 1916 for French by Jean-Baptiste Estoup, a French stenographer [19]. Similar results for English are known from no later than 1928, when the American nuclear physicist Edward Uhler Condon reported his findings [20]. These results are much better known from the works by George Kingsley Zipf, an American linguist [21, 22], and the respective dependence is traditionally referred to as Zipf’s law:

fr=Arz.subscript𝑓𝑟𝐴superscript𝑟𝑧\displaystyle f_{r}=\frac{A}{r^{z}}. (1)

The exponent z𝑧z has values close to unity and depends in particular on language and genre [23, 24, 25, 26]. Originally, Zipf used z=1𝑧1z=1 for English.

Zipfian dependences are typical of complex systems of various sorts [27, 28], not being unique to linguistic units [29, 30, 31, 32, 33]. For instance, Zipf’s law holds for city sizes based on census data [34], indirect estimation from number of customers in restaurants [35], and sizes of natural cities defined from nighttime satellite images [36].

Zipf’s law was also found in distributions of musical units [37] and various units in genomic studies, including k𝑘k-mers in genomes [38] and abundances of expressed genes [39]. In economic context, it describes in particular wealth distribution [40] and distribution of firm sizes in the United States [41].

The origins of power laws, of which Zipf’s law is a particular example, has been examined from various viewpoints[42, 43, 44, 45] and it has been suggested that Zipf’s law has a fundamental role in natural languages not being reproducible in random, so-called monkey-typed, texts[46, 47].

Obviously, the rank–frequency distributions in reality are more complex than predicted by the simple Zipfian model [31]. From Fig. 1 we can observe that low ranks can significantly deviate from expected linear dependence when plotted in the log-log scale. To account for such situations, Benoît Mandelbrot [48] suggested the following generalization of (1)

fr=C(M+r)Bsubscript𝑓𝑟𝐶superscript𝑀𝑟𝐵\displaystyle f_{r}=\frac{C}{(M+r)^{B}} (2)

commonly known as the Zipf–Mandelbrot law. Similarly to Zipf’s law, it is applicable in a vast variety of problems, reaching as far as, e. g., regularities observed in football matches[49].


[Uncaptioned image]

George Kingsley Zipf

(07.01.1902 – 25.09.1950)

Source: https://peoplepill.com/people/
george-kingsley-zipf

[Uncaptioned image]

Benoît B. Mandelbrot

(20.11.1924 – 14.10.2010)

Courtesy: AIP Emilio Segrè Visual Archives, Physics Today Collection


In Fig. 2, fitting results with models (1) and (2) are compared. Here and further in this Chapter, fitting is done using the nonlinear least-squares Marquardt–Levenberg algorithm implemented in the fit procedure of GnuPlot, version 5.2.

Refer to caption

Figure 2: Rank–frequency dependence for the Ukrainian translation of Alice’s Adventures in Wonderland fitted using Zipf’s law (1) and the Zipf–Mandelbrot law (2). The fitting parameters for (1) are A=1786±7𝐴plus-or-minus17867A=1786\pm 7, z=0.952±0.001𝑧plus-or-minus0.9520.001z=-0.952\pm 0.001, the fitting range is r10𝑟10r\geq 10. The fitting parameters for (2) are as follows: C=3524±50𝐶plus-or-minus352450C=3524\pm 50, M=4.91±0.05𝑀plus-or-minus4.910.05M=4.91\pm 0.05, B=1.083±0.004𝐵plus-or-minus1.0830.004B=1.083\pm 0.004 (own results)

Studies of large text collections (called corpora being plural of corpus) demonstrate a significant change in the value of the Zipfian exponent (from z1similar-to-or-equals𝑧1z\simeq 1 to z2greater-than-or-equivalent-to𝑧2z\gtrsim 2) at some high ranks that are not typically achieved for smaller samples. Such a change corresponds thus to two regimes in rank–frequency dependences that can be identified with different types of vocabulary [29, 50]. The first one with z1similar-to-or-equals𝑧1z\simeq 1 might correspond to some core vocabulary. In fact, such two regimes can be also observed even in smaller samples[23, 51] but they are less pronounced. In Fig. 1 we can observe a similar behavior for the Hawaiian data. Marcelo Montemurro[52] suggested the following model with two exponents to recover such a two-regime behavior:

fr=Dλrx+(1λ)ry.subscript𝑓𝑟𝐷𝜆superscript𝑟𝑥1𝜆superscript𝑟𝑦\displaystyle f_{r}=\frac{D}{\lambda r^{x}+(1-\lambda)r^{y}}. (3)

To conclude this section, it is worth mentioning another model for rank–frequency dependence, known as the continuous model of the Yule distribution

fr=Fkrrb.subscript𝑓𝑟𝐹superscript𝑘𝑟superscript𝑟𝑏\displaystyle f_{r}=F\frac{k^{r}}{r^{b}}. (4)

Usually, this model works well if the number of types is not large, a few tens or perhaps hundreds. In particular, relevant linguistic units are letters, phonemes, or syllables (in languages with strong phonotactic restrictions), cf. Refs. 53, 54, 55.

3 “Temperature” in linguistics

Occasionally, the notion of ‘temperature’ is used in a wide abstract sense, without reference to any quantitative parametrization, cf. Anna Wierzbicka’s ‘emotional temperature’ [56, p. 395]. A rather simple notion of ‘verbal temperature’ or its modification, ‘infinitive temperature’ as the fraction of verbs (or infinitives, respectively) is also known [57, 58].

Benoît Mandelbrot was perhaps the first to introduce the concept of temperature in linguistic studies referring to physical considerations. In 1951, he coined the term température cybernétique du message [48] (the informational temperature of the text [59]) for the quantity θ=1/B𝜃1𝐵\theta=1/B in the rank–frequency dependence model (2).

Leaping several decades, we arrive at the beginning of the 21st century when several loosely related approaches involving temperature were suggested by various authors.

Kosmidis et al.[60] introduce a measure of a word usefulness k𝑘k. As the authors explain, it is related to the extent the word is essential for survival of an organized group of people. Postulating the respective (single-word) Hamiltonian as H(k)=εlnk𝐻𝑘𝜀𝑘H(k)=\varepsilon\ln k they obtain the probability to find a word with usefulness k𝑘k as

p(k)=1ZeH(k)/kBT=1Zkε/kBT,𝑝𝑘1𝑍superscript𝑒𝐻𝑘subscript𝑘B𝑇1𝑍superscript𝑘𝜀subscript𝑘B𝑇\displaystyle p(k)=\frac{1}{Z}e^{-H(k)/k_{\rm B}T}=\frac{1}{Z}k^{-\varepsilon/k_{\rm B}T}, (5)

with Z𝑍Z being the partition function defined in a standard way. The “temperature” T𝑇T is considered to be ‘a measure of the willingness (or ability) that the language speakers have in order to communicate’ [60]. Curiously, from the assumption that the usefulness of a word is roughly proportional to its rank, the following estimation for the Zipfian exponent can be obtained:

zεkBT.similar-to-or-equals𝑧𝜀subscript𝑘B𝑇\displaystyle z\simeq\frac{\varepsilon}{k_{\rm B}T}. (6)

The Boltzmann distribution was later applied by Miyazima and Yamamoto [61] within an innovative approach for the measurement of temperature of texts. The authors suggested that the relative frequency of a word in the American National Corpus (ANC) pwordsubscript𝑝wordp_{\rm word} can be expressed using the word’s energy Ewordsubscript𝐸wordE_{\rm word} and a parameter T𝑇T called ‘temperature’:

pword=eEword/kBT.subscript𝑝wordsuperscript𝑒subscript𝐸wordsubscript𝑘B𝑇\displaystyle p_{\rm word}=e^{-E_{\rm word}/k_{\rm B}T}. (7)

The Boltzmann constant is then set to unity kB=1subscript𝑘B1k_{\rm B}=1 and the temperature of the ANC is assumed to be T=100𝑇100T=100 K (with kelvins serving units for both energy and temperature). In this way, values of Ewordsubscript𝐸wordE_{\rm word} are uniquely defined for every word based on its frequency in ANC. To measure the temperature t𝑡t of a given text, one should fit the observed word frequencies using the function

pwordobs.=AeEword/t.superscriptsubscript𝑝wordobs𝐴superscript𝑒subscript𝐸word𝑡\displaystyle p_{\rm word}^{\rm obs.}=Ae^{-E_{\rm word}/t}. (8)

The values of t𝑡t calculated for some English texts vary between 65 and 148 K [61]. It should be noted that only the 100 most frequent words are considered in the calculations.

A similar approach was later used by Chang et al.[62]. In that work, the so-called information-based energy was also introduced, with the definition involving the Shannon entropy, as opposed to total energy defined in a standard way.

In 2010, we suggested another model involving the temperature parameter, which was based on the Bose–Einstein distribution [63, 64]. The underlying idea was to fit the observed frequency spectrum using the function

Nj=1z1eεj/T1,subscript𝑁𝑗1superscript𝑧1superscript𝑒subscript𝜀𝑗𝑇1\displaystyle N_{j}=\frac{1}{z^{-1}e^{\varepsilon_{j}/T}-1}, (9)

where the “fugacity” z𝑧z is fixed by the number of hapax legomena

z=N1N1+1𝑧subscript𝑁1subscript𝑁11\displaystyle z=\frac{N_{1}}{N_{1}+1} (10)

and the spectrum is chosen in a simple form

εj=(j1)α,1<α<2.formulae-sequencesubscript𝜀𝑗superscript𝑗1𝛼1𝛼2\displaystyle\varepsilon_{j}=(j-1)^{\alpha},\qquad 1<\alpha<2. (11)

In such a model, only several lowermost j𝑗js contribute significantly as Njsubscript𝑁𝑗N_{j} rapidly drops at large values of εjsubscript𝜀𝑗\varepsilon_{j}. For practical purposes it is thus reasonable to fit the observed data using (9)–(11) via two parameters, α𝛼\alpha and T𝑇T, for j=2÷jmax𝑗2subscript𝑗maxj=2\div j_{\rm max} [note that j=1𝑗1j=1 is used to fix z𝑧z, see Eq. (10)].

To apply some “natural” definition for the upper limit jmaxsubscript𝑗maxj_{\rm max} one can use the so-called k𝑘k-point, which is the largest value of j𝑗j satisfying Njjsubscript𝑁𝑗𝑗N_{j}\geq j. It is suggested that the k𝑘k-point roughly marks a border in the vocabulary between high-frequency synsemantic (auxiliary or function) words and low-frequency autosemantic (meaningful) words [14, p. 37]. Typical values of jmaxsubscript𝑗maxj_{\rm max} in our studies are 10–15.

An example of the fitting is shown in Fig. 3 for the frequency spectrum obtained from the translation of Alice’s Adventures in Wonderland in Swahili.222For the original studies[16, 17] with this novel, various open sources were used to collect texts in different languages during 2013–2015. Those websites are mostly down nowadays, unfortunately. As of April 2022, the Swahili translation can be located at https://www.maktaba.org/download/file/538.

Refer to caption

Figure 3: Frequency spectrum for the Swahili translation of Alice’s Adventures in Wonderland fitted using (9). The upper limit for fitting is jmax=14subscript𝑗max14j_{\rm max}=14. The values of the fitting parameters are as follows: α=1.25±0.06𝛼plus-or-minus1.250.06\alpha=1.25\pm 0.06, T=446±20𝑇plus-or-minus44620T=446\pm 20 (own results)

The approaches from Ref. 61 and Refs. 63, 64 were recently applied to the analysis of Ragas, melodic elements in Indian classical music [65]. The possibility to use the obtained parameters in the categorization of Ragas was demonstrated.

As we will see in subsequent Sections, the “temperatures” from (9)–(11) can be related to certain properties of language grammar. Similar observations with other approaches described above concern, in particular, relations of the respective “temperatures” and vocabulary size growth in children with age[60], changes in textbooks of English as a foreign language between junior and senior high schools in Japan[61], and even a measure of writer’s creativity[62].

4 “Temperature” scaling

Even superficial analysis shows that the parameter T𝑇T significantly depends on the number of tokens N𝑁N. From the first glance this might be surprising as in physics temperature is an intensive property, i. e., not depending on the number of particles in the system. A way to drive the analogy back into the corral is, in fact, the thermodynamic limit notion.

Usually, for N𝑁N particles confined in a box of volume V𝑉V, the thermodynamic limit is defined so that the ratio N/V𝑁𝑉N/V is kept constant while N𝑁N\to\infty and V𝑉V\to\infty simultaneously. No temperature enters this definition. But the situation becomes very different if particles are placed in an external potential. For the trapping potential in the form U(r)ωrnproportional-to𝑈𝑟𝜔superscript𝑟𝑛U(r)\propto\omega r^{n}, the thermodynamic limit condition reads [66]

Nωs=constwhileNandω0,formulae-sequence𝑁superscript𝜔𝑠constwhileformulae-sequence𝑁and𝜔0\displaystyle N\omega^{s}={\rm const}\qquad\textrm{while}\quad N\to\infty\ \ \textrm{and}\ \ \omega\to 0, (12)

where the exponent

s=D(12+1n)𝑠𝐷121𝑛\displaystyle s=D\left(\frac{1}{2}+\frac{1}{n}\right) (13)

is defined by the potential power n𝑛n and the space dimensionality D𝐷D.

So, for instance, the critical (Bose condensation) temperature given by[66] TcN1/sproportional-tosubscript𝑇𝑐superscript𝑁1𝑠T_{c}\propto N^{1/s} depends indeed on the number of particles and is kept constant only if the thermodynamic limit conditions (12) are held.

The model used to define the “temperature” parameter in Eqs. (9)–(11) does not account for any thermodynamic limiting transition, hence it is quite natural to expect that T𝑇T grows as N𝑁N increases.

The scaling was empirically proved[63, 16, 67] to be described very precisely by a simple power-law dependence

T=tNβ,𝑇𝑡superscript𝑁𝛽\displaystyle T=tN^{\beta}, (14)

and the following parameter (weakly-dependent on N𝑁N) was initially[63, 64] used to make comparative analysis:

τ=lnTlnN.𝜏𝑇𝑁\displaystyle\tau=\frac{\ln T}{\ln N}. (15)

Empirically we have also discovered a strong inverse correlation between τ𝜏\tau and β𝛽\beta [67]. Assuming the power-law connection

β=btawitha>0formulae-sequence𝛽𝑏superscript𝑡𝑎with𝑎0\displaystyle\beta=bt^{-a}\qquad\textrm{with}\quad a>0 (16)

we obtain immediately the link between τ𝜏\tau and β𝛽\beta as follows

τ=β+1alnblnβlnN.𝜏𝛽1𝑎𝑏𝛽𝑁\displaystyle\tau=\beta+\frac{1}{a}\frac{\ln b-\ln\beta}{\ln N}. (17)

Obviously, in the limit of large N𝑁N, the parameters τ𝜏\tau and β𝛽\beta coincide. However, in practice the values of N𝑁N in the problems analyzed so far have been too small (typically, N104similar-to𝑁superscript104N\sim 10^{4}) thus the logarithm being too weak to eliminate the contribution of the second term in \erefeq:tau-beta.

Here, it will be too hard to avoid deeping into physics for a moment (for the second time in this short Section!). Anyway, I will try to stay as shallowly as possible keeping in mind Altmann’s warning mentioned in the Introduction. The physical analogy presented below was initially put forward in Ref. 68.

So, in thermodynamics the Gibbs free energy G𝐺G is related to the number of particles N𝑁N and the chemical potential μ=Tlnz𝜇𝑇𝑧\mu=T\ln z, where z𝑧z is the very fugacity parameter from \erefeq:Nj-exp, namely, G=μN𝐺𝜇𝑁G=\mu N. For the chemical potential one can easily obtain an expression via the number of hapaxes N1subscript𝑁1N_{1}:

μ=Tlnz=TlnN1N1+1TN1𝜇𝑇𝑧𝑇subscript𝑁1subscript𝑁11similar-to-or-equals𝑇subscript𝑁1\displaystyle\mu=T\ln z=T\ln\frac{N_{1}}{N_{1}+1}\simeq-\frac{T}{N_{1}} (18)

in the leading order assuming N1subscript𝑁1N_{1} being large. From the nature of G𝐺G it follows that it is an extensive quantity, thus GNproportional-to𝐺𝑁G\propto N. This means in turn that μ𝜇\mu does not depend on N𝑁N. If we then consider the scaling for the number of hapaxes[69] N=cNγ𝑁𝑐superscript𝑁𝛾N=cN^{\gamma} and the scaling of temperature (14) we immediately see that exponents β𝛽\beta and γ𝛾\gamma should coincide. This relation really holds to a good accuracy [68].

5 Nucleotide sequences

[Uncaptioned image]

George Gamow
  (04.03.1904 – 19.08.1968)

Courtesy: AIP Emilio Segrè
  Visual Archives, Physics
 Today Collection

While usual texts of words certainly exemplify complex systems of repeated tokens that are easy to collect and analyze, there are plenty of others. One can think, in particular, of genomes collected in large freely accessible databases[70, 71, 72]. George Gamow[73, 74, 75] was likely the first[76] to suggest a linguistics analogy between nucleotide sequences in the molecules of deoxyribonucleic acid (DNA) and words in human languages, soon upon discovery of the DNA structure in 1953 by Watson & Crick[77]. Note that a decade earlier, Erwin Schrödinger used the term “hereditary code-script”[78, Chap. 2] with similar allusions[76]. In this Section, I will describe some typical linguistic analogies used in DNA studies complementing them by my own recently suggested approach[79] mostly applicable for comparatively short sequences.

For integrity, it is worth recalling briefly the structure of DNA molecules. They are composed of two polynucleotide chains (strands) made up of the following four nucleobases: adenine (A), cytosine (C), guanine (G), and thymine (T) [80, p. 175]. Nucleotides proper are formed as a nucleobase with a five-carbon sugar molecule (deoxyribose) and a phosphate group attached. Within a strand, strong covalent bonds occur between any bases while weaker hydrogen bonds between the strands have certain peculiarities. Only two types of such bonds are possible: adenine links with thymine and cytosine links with guanine. Such links form base pairs (bp) and their number is used to measure the length of DNA molecules.

Ribonucleic acid (RNA) molecules have a slightly different structure comparing to DNA. The five-carbon sugar is ribose and there is a change in the set of four nucleobases: uracil (U) in place of thymine (T) [80, p. 39]. Unlike DNA, RNA molecules are mostly single-stranded. For the sake of homogeneity in data representation, in the NCBI databases the RNA structure uses T instead of U, and RNA sizes are quoted in bp (base pairs) instead of bases.

Genome sizes are often expressed in kilobases (1 kb = 1000 bp) or megabases (1 Mb = 1 000 000 bp). They vary in a very large range, from a few kilobases in case of viruses to over 105superscript10510^{5} Mb in some plants [81]. To achieve relative homogeneity of the analyzed data, further the study is limited to viral RNA and mammalian mitochondrial DNA (mtDNA). The latter is a closed-circular, double-stranded molecule containing 16–17 kbp [82].

In this Chapter, DNA and RNA building blocks are referred to as nucleotides and denoted by the respective nucleobase letter (A, C, G, or T) for simplicity. This does not cause any ambiguity or confusion for the purposes of the presented studies.

Nucleotide triplets, i. e., sequences of three nucleotides, are known as codons. For instance, Leucine (Leu), which is an essential amino acid, is encoded by the following codons: TTA, TTG, CTA, CTC, CTG, and CTT. Another essential amino acid, Valine (Val) is encoded by the codons GTA, CTC, GTG, and GTT. Certain combinations (TAA, TAG, and TGA) are stop codons [80].

Larger structures include genes and polypeptides. Genes are typically composed of hundreds and thousands of base pairs but can achieve much larger sizes [83, 84]. Polypeptides are composed of many amino acids, and one or more polypeptides further form proteins [85].

Various approaches to establish the linguistics analogy in genome studies are attested. In particular, Brendel et al.[86] considered nucleotides as letters and k𝑘k-mers as words. Trifonov et al. consider also frequently repeating nucleotide sequences (motifs) [87]. Sungchul Ji[88, 89] lists analogy with more levels:

  • letters – 4 nucleotides or 20 amino acids;

  • words – genes or polypeptides;

  • sentences – sets of genes;

  • even “punctuation” as starting and terminating codons.

Focusing on relatively short genomes (mtDNA or virus RNA) one should look for some other units comparing to those mentioned above in order to achieve word-like behavior. Even for larger genomes, various deviations from Zipfian dependences in rank–frequency distributions of nucleotide n𝑛n-tuples are observed in coding and non-coding DNA sequences [90].

The following approach was suggested [79] to analyze relatively short genomes: substitute the most frequent nucleotide with a space and insert an empty sequence (denoted by X) between two consecutive spaces. For instance, given the human mtDNA (Homo sapiens[91])

GATCACAGGTCTATCACCCTATTAACCACTCACGGGA…,GATCACAGGTCTATCACCCTATTAACCACTCACGGGA…\textrm{GATCACAGGTCTATCACCCTATTAACCACTCACGGGA\ldots},

where adenine (A) is the most frequent nucleotide, we obtain

G  TC  C  GGTCT  TC  CCCT  TT  X  CC  CTC  CGGG  ….G  TC  C  GGTCT  TC  CCCT  TT  X  CC  CTC  CGGG  …\textrm{G \ TC \ C \ GGTCT \ TC \ CCCT \ TT \ X \ CC \ CTC \ CGGG \ \ldots}\ .

It appears that the resulting nucleotide sequences (“words” between “spaces”) exhibit significant similarities with words in natural languages in their rank–frequency distributions [79, 92]. These very sequences are studied in Subsecs. 2 and 2.

6 Some results with “temperatures”

In this Section, two rather different applications of approaches based on the “temperature” parameter are considered. The first problem deals with texts and the possibility to quantify some their properties relevant to the evolution of languages. In the second problem, mitochondrial genomes are considered within the linguistic analogy described above and fitting of respective frequency spectra with a modified version of distribution (9) is studied.

1 Language evolution

Studies of several texts in a few dozen languages from very different language families[63, 64, 68, 16] revealed certain common properties of the parameters obtained while fitting frequency spectra within the procedure represented by Eqs. (9)–(11). The main observation is that for languages with higher analyticity level (less word inflection) the values of τ=lnT/lnN𝜏𝑇𝑁\tau=\ln T/\ln N and α𝛼\alpha are lower comparing to more synthetic languages. The reason of such a difference lies in different proportions of low-frequency words in case of analytic and synthetic languages—and indeed, these are low-frequency data that define the parameters in this “temperature” approach. Note that high-frequency vocabulary also behaves differently in analytic and synthetic languages, with the rank–frequency dependences being “more Zipfian” for the former, but this is not relevant for the analysis presented below.

Change of the parameters with time might be associated with a possibility to quantify the evolution of languages. Such an analysis requires texts produced at different language stages (for instance, Classical Greek and Modern Greek) or in historically related languages (Latin, Italian, Spanish). Naturally, significant differences can be expected for time lapses of at least several centuries. The best (and perhaps the only) option is to utilize religious texts. Fortunately, the availability of Anglo-Saxon version of the Gospel of John (first nine chapters)[93] encouraged me to make studies of several language lineages[68, 94].

The available texts333The texts were collected in 2012–2013 from open resources once available at http://unbound.biola.edu and http://gospelgo.com/bibles.htm (both currently down). I am able to provide raw plain text sources upon request. were processed ultimately yielding frequency spectra to be fitted according to the scheme given by Eqs. (9)–(11). As the result, each version of the Gospel of John was characterized by two parameters, τ𝜏\tau and α𝛼\alpha. Figure 4 shows results for several most interesting languages to be briefly discussed below.

Refer to caption

Figure 4: Translations of the Gospel of John in several languages (codes are given according to the ISO 639-3 standard[95], except for ISO 639-6 emen for the Early Modern English). Arrows demonstrate the evolution direction. Error bars show uncertainties in the determination of the fitting parameters. This figure contains partial data from previously published studies[68, 94]

Generally, the evolution is directed south west, form the domain of higher values of both τ𝜏\tau and α𝛼\alpha to the domain of lower τ𝜏\tau and α𝛼\alpha. This is exemplified by the following lineages:

  • Classical Greek (grc) to Modern Greek (ell);

  • Latin (lat) to Spanish (spa) via French (fra) and Italian (ita);

  • Old Church Slavonic (chu) to Bulgarian (bul) via the domain surrounded by Polish (pol), Russian (rus), and Ukrainian (ukr).

This supports the observations regarding the analytic and synthetic nature of language grammar described above. Moreover, we see that simplification of grammar with time is clearly seen. The best example is complex Old Church Slavonic and its close relative, modern Bulgarian, that almost lost noun inflection. Such results corroborate classical Greenberg’s data[96].

The opposite (south east) arrow joins the Anglo-Saxon (ang, Old English) language with the domain between the Early Modern English (emen) and Modern English (eng). For convenience, some other Germanic languages are shown: Icelandic (isl), German (deu), and Danish (dan)—listed here roughly in the order of decreasing grammar complexity. This peculiarity in the English lineage might reflect a turbulent history of its interaction with other languages (including French). Still, the simplification of grammar is preserved at least in the decrease in the τ𝜏\tau parameter.

2 Distributions with deformed exponentials for genomes

The studies of frequency spectra obtained from rank–frequency distributions of nucleotide sequences (as defined at the end of \srefsec:Genomes, page 5) in mammalian mtDNA[79] and virus RNA[97] showed qualitative similarities with those of ordinary words. However, the decay of the genomic frequency spectra at large j𝑗j appeared not as fast as in texts. So, a modification of (9) might be required to catch such a large-j𝑗j behavior more accurately. It was suggested[79] to use the following model

Nj=1z1X(εj/T)1,subscript𝑁𝑗1superscript𝑧1𝑋subscript𝜀𝑗𝑇1\displaystyle N_{j}=\frac{1}{z^{-1}X(\varepsilon_{j}/T)-1}, (19)

where X(t)𝑋𝑡X(t) is not the ordinary exponential but some other function.

The following two deformed exponentials were analyzed. The first one was the Tsallis q𝑞q-exponential is defined as[98]

eqx={exp(x),for q=1,[1+(1q)x]1/(1q),for q1and 1+(1q)x>0,01/(1q),for q1and 1+(1q)x0.superscriptsubscript𝑒𝑞𝑥cases𝑥for 𝑞1superscriptdelimited-[]11𝑞𝑥11𝑞for 𝑞1and11𝑞𝑥0superscript011𝑞for 𝑞1and11𝑞𝑥0\displaystyle e_{q}^{x}=\left\{\begin{array}[]{ll}\exp(x),&\textrm{for\ }q=1,\\[6.0pt] [1+(1-q)x]^{1/(1-q)},&\textrm{for\ }q\neq 1\ \textrm{and}\ 1+(1-q)x>0,\\[6.0pt] 0^{1/(1-q)},&\textrm{for\ }q\neq 1\ \textrm{and}\ 1+(1-q)x\leq 0.\end{array}\right. (23)

It is a well-known function in nonextensive formulations of statistical mechanics[99, 100] and is applied in modeling fat-tail distributions in various domains[101, 102, 103].

The second considered alternative is the kappa-exponential of Kaniadakis given by[104, 105]

expϰ(x)=(1+ϰ2x2+ϰx)1ϰ.subscriptitalic-ϰ𝑥superscript1superscriptitalic-ϰ2superscript𝑥2italic-ϰ𝑥1italic-ϰ\displaystyle\exp_{\varkappa}(x)=\left(\sqrt{1+\varkappa^{2}x^{2}}+\varkappa x\right)^{\frac{1}{\varkappa}}. (24)

This function also appears in studies of complex systems to account for power-law distributions[106, 107, 108]. Both deformed exponentials reduce to the ordinary exponential in the limits of q1𝑞1q\to 1 and ϰ0italic-ϰ0\varkappa\to 0, respectively.

Refer to caption

Figure 5: Fitting results for the frequency spectrum of nucleotide sequences in human mtDNA. Curve 1 corresponds to the ordinary exponential (T=88.8±3.2𝑇plus-or-minus88.83.2T=88.8\pm 3.2), curve 2 corresponds to the kappa-exponential (T=88.4±1.6𝑇plus-or-minus88.41.6T=88.4\pm 1.6,  ϰ=4.3±1.1italic-ϰplus-or-minus4.31.1\varkappa=4.3\pm 1.1), and curve 3 stands for the Tsallis q𝑞q-exponential (T=86.4±1.8𝑇plus-or-minus86.41.8T=86.4\pm 1.8,  q=1.4±0.8𝑞plus-or-minus1.40.8q=-1.4\pm 0.8); all the data are own results

In \freffig:H-Homo_sapiens-spectrum, results of fitting the frequency spectrum obtained for nucleotide sequences in human mitochondrial genome[91] are shown. Three different curves correspond to X(t)𝑋𝑡X(t) in \erefeq:Nj-X being the ordinary exponential, the Tsallis q𝑞q-exponential (23), and the kappa-exponential (24). All the calculations are made at the fixed value of α=1.5𝛼1.5\alpha=1.5 in εj=(j1)αsubscript𝜀𝑗superscript𝑗1𝛼\varepsilon_{j}=(j-1)^{\alpha}. The value of z𝑧z is calculated using the number of hapaxes N1=548subscript𝑁1548N_{1}=548. Negative values of q𝑞q, while surprising at first glance, are not uncommon in studies involving the Tsallis q𝑞q-exponential[109, 110, 111].

When similar calculations were made for some mammalian mtDNA[79], the mean value of ϰitalic-ϰ\varkappa for the Felidae family appeared to be larger than that of the Ursidae (ϰF=6.3subscriptdelimited-⟨⟩italic-ϰF6.3\langle\varkappa\rangle_{\rm F}=6.3 versus ϰB=5.1subscriptdelimited-⟨⟩italic-ϰB5.1\langle\varkappa\rangle_{\rm B}=5.1) yielding the conclusion that cats generally have longer tails than bears .

The presented examples show potential applicability of parameters associated with “temperature” in discrimination of various complex systems (text and biological species), although in many cases as a supplementary tool only owing to high uncertainties in calculations. In the following Sections, the use of another physically inspired quantity—entropy—together with some other parameters derivable from rank–frequency distributions is demonstrated.

7 Entropy and some other frequency- and length-related parameters

The concept of entropy can be traced back to 1850 when it appeared under different names in works by William Rankine and Rudolf Clausius[112, 113] and later developed by the latter. The term itself originates in the work of Rudolf Clausius[114]. For historical reference, the Clausius’s passage containing the discussion about the naming is reproduced in Fig. 6.

Refer to caption

Figure 6: The fragment of Clausius’s 1865 paper[114] (page 390) in Annalen der Physik und Chemie containing the justification of the new term, Entropie.
[Uncaptioned image]

Rudolf Clausius
  (02.01.1822 – 24.08.1888)

Courtesy: AIP Emilio Segrè
  Visual Archives,
   Lande Collection


A Google-assisted translation of the passage reads:

If one looks for a descriptive name for S𝑆S, one could say, similarly to what is said of the quantity U𝑈U, that it is the body’s heat and work content, and of the quantity S𝑆S that it is the body’s content of transformation. However, since I think it is better to take the names of such scientifically important quantities from the old languages so that they can be used unchanged in all new languages, I propose to use for the quantity S𝑆S the Greek word ἡ τροπή, the transformation, to name it the  e n t r o p y  of the body. I deliberately formed the word entropy as similar as possible to the word energy, because the two quantities to be named by these words are so closely related in their physical meanings that a certain similarity in the naming seems to me to be expedient.


Microscopic considerations toward the definition of entropy were started by Boltzmann[115] in the 1870s but the well known relation S=klogW𝑆𝑘𝑊S=k\log W between entropy and the number of microstates W𝑊W was explicitly written for the first time by Planck[116] in 1901.

[Uncaptioned image]

Josiah Willard Gibbs
  (11.02.1839 – 28.04.1903)

Courtesy: AIP Emilio Segrè
  Visual Archives

Subsequent developments in the domain of statistical mechanics are also due to Josiah Willard Gibbs. It seems, however, that what we usually call the Gibbs formula for entropy, S=plnp𝑆𝑝𝑝S=-\sum p\ln p (or its equivalent expression for continuous variables via integral), had never been written by Gibbs himself. This expression can be obtained from the wording at the end of Chap. IV of Gibbs’ original book [117] published in 1902, see \freffig:Gibbs1902-page45. The location of this expression appeared not an easy task though and was made thanks to Ref. 118.


Refer to caption


Figure 7: The fragment of Gibbs’s 1902 book[117] (page 45) containing a passage related to the definition of entropy that is denoted by η𝜂\eta. The book was digitized by Google and is available from https://archive.org

The concept of entropy was brought into information theory by Claude Shannon[119, 120]. For a discrete random variable X𝑋X achieving values x1,,xMsubscript𝑥1subscript𝑥𝑀x_{1},\ldots,x_{M} with probabilities p1,,pMsubscript𝑝1subscript𝑝𝑀p_{1},\ldots,p_{M}, respectively, the following expression defines the entropy:

H=r=1Mprlogbpr,𝐻superscriptsubscript𝑟1𝑀subscript𝑝𝑟subscript𝑏subscript𝑝𝑟H=-\sum_{r=1}^{M}p_{r}\log_{b}p_{r}, (25)
[Uncaptioned image]

Claude Elwood Shannon
  (30.04.1916 – 24.02.2001)

Source: Ref. 121

Aiming at measuring the information in bits, one should use b=2𝑏2b=2; choosing the natural (base e𝑒e) logarithm one obtains information in nats [122, 123]. Binary (base 2) logarithms are considered most common in information theory[123]. Shannon didn’t specify explicitly the base in his original definitions but, for instance, from transformations given on page 630 of his original paper[120] one can conclude that he used the natural logarithm.

The use of entropy as a discriminating parameter might be rooted in its role as a measure of disorder[124, 113]. This was the main motivation for me to consider it—alongside other available quantities—in several studies devoted to the classification of complex systems[79, 125, 92].

Given a rank–frequency distribution, upon introducing the probability or relative frequency pr=fr/Nsubscript𝑝𝑟subscript𝑓𝑟𝑁p_{r}=f_{r}/N, one can define entropy as follows:

S=r=1Vprlnpr,𝑆superscriptsubscript𝑟1𝑉subscript𝑝𝑟subscript𝑝𝑟S=-\sum_{r=1}^{V}p_{r}\ln p_{r}, (26)

where the upper summation limit corresponds to the total number of types. Note that the normalization condition reads

r=1Vpr=1=1Nr=1Vfr=N.superscriptsubscript𝑟1𝑉subscript𝑝𝑟11𝑁subscriptsuperscriptsubscript𝑟1𝑉subscript𝑓𝑟absent𝑁\sum_{r=1}^{V}p_{r}=1=\frac{1}{N}\underbrace{\sum_{r=1}^{V}f_{r}}_{=N}. (27)

There are also plenty of other indicators that can be obtained from rank–frequency distributions. Recalling that the number of tokens is N𝑁N and the number of types is V𝑉V, one can summarize the following list of ten parameters[125]: {itemlist}

type-token ratio TTR = V/N𝑉𝑁V/N;

number of hapax legomena  N1subscript𝑁1N_{1};

number of dis legomena  N2subscript𝑁2N_{2};

fraction of hapax legomena  N1/Nsubscript𝑁1𝑁N_{1}/N;

fraction of dis legomena  N2/Nsubscript𝑁2𝑁N_{2}/N;

relation of hapax and dis legomena  N1/N2subscript𝑁1subscript𝑁2N_{1}/N_{2};

repeat rate R𝑅R [126]:

R=r=1Vpr2=1N2r=1Vfr2𝑅superscriptsubscript𝑟1𝑉superscriptsubscript𝑝𝑟21superscript𝑁2superscriptsubscript𝑟1𝑉superscriptsubscript𝑓𝑟2R=\sum_{r=1}^{V}p_{r}^{2}=\frac{1}{N^{2}}\sum_{r=1}^{V}f_{r}^{2} (28)

relative repeat rate Rrelsubscript𝑅relR_{\rm rel}

Rrel=1R11/Vsubscript𝑅rel1𝑅11𝑉R_{\rm rel}=\frac{1-R}{1-1/V} (29)

h-point :

h={rif there exists a solution of r=frf1r2f2rrr2r1+f1f2otherwise; note that f1>r1 and f2<r2cases𝑟if there exists a solution of r=frsubscript𝑓1subscript𝑟2subscript𝑓2subscript𝑟𝑟subscript𝑟2subscript𝑟1𝑓1subscript𝑓2otherwise; note that f1>r1 and f2<r2h=\left\{\begin{array}[]{cl}r&\ \textrm{if there exists a solution of $r=f_{r}$}\\[6.0pt] \displaystyle\frac{f_{1}r_{2}-f_{2}r_{r}}{r_{2}-r_{1}+f1-f_{2}}&\ \textrm{otherwise; note that $f_{1}>r_{1}$ and $f_{2}<r_{2}$}\end{array}\right. (30)

index a𝑎a being the scaling coefficient for the h-point (Popescu et al 2009):

a=Nh2𝑎𝑁superscript2a=\frac{N}{h^{2}} (31)

Several parameters can be calculated if a unit to measure the length of a token is introduced. This will be specified in the respective sections. The length-related parameters are: {itemlist}

mean token length (first central moment)

m1=1Ni=1Nxi,subscript𝑚11𝑁superscriptsubscript𝑖1𝑁subscript𝑥𝑖m_{1}=\frac{1}{N}\sum_{i=1}^{N}x_{i}, (32)

where the summation runs over all the tokens of the analyzed sample and xisubscript𝑥𝑖x_{i} is the length of the i𝑖ith token.

dispersion of token length (second central moment)

m2=1Ni=1N(xim1)2.subscript𝑚21𝑁superscriptsubscript𝑖1𝑁superscriptsubscript𝑥𝑖subscript𝑚12m_{2}=\frac{1}{N}\sum_{i=1}^{N}(x_{i}-m_{1})^{2}. (33)

dispersion quotient

d=m2m11𝑑subscript𝑚2subscript𝑚11d=\frac{m_{2}}{m_{1}-1} (34)

fraction of tokens with length n𝑛n denoted as snsubscript𝑠𝑛s_{n}.

It was shown that some of the parameters listed above are relevant in genre or author attribution of texts. These include, for instance, d𝑑d and s4subscript𝑠4s_{4} considered in Ref. 127 or Rrelsubscript𝑅relR_{\rm rel} as one of the parameters for multivariate analysis[126].

With the above defined quantities at hand, we will be able to experiment a bit in order to define their potential in discriminating complex systems. And what’s more, in some cases nearly straightforward physics-based interpretation become possible as is demonstrated in the next Section.

8 Some results with entropy et alii

In order to direct the abstract discussion on entropy into a more settled down way, it is worth considering a toy example of a text with six tokens. Depending on the number of types we can calculate entropies as shown in \treftab:S.

\tbl

Entropies for different six-token texts \topruleText Types (fisubscript𝑓𝑖f_{i}) Entropy \colruleA B C D E F: A (1) … F (1) S=616ln16=ln61.79𝑆616166similar-to-or-equals1.79S=-6\cdot\frac{1}{6}\cdot\ln\frac{1}{6}=\ln 6\simeq 1.79 A A A A A A: A (6) S=1ln1=0𝑆110S=-1\cdot\ln 1=0 A A A D E F: A (3), D (1) … F (1) S=12ln12316ln161.24𝑆121231616similar-to-or-equals1.24S=-\frac{1}{2}\cdot\ln\frac{1}{2}-3\cdot\frac{1}{6}\cdot\ln\frac{1}{6}\simeq\mathbf{1.24} A A A D D F: A (3), D (2), F (1) S=12ln1213ln13216ln161.31𝑆1212131321616similar-to-or-equals1.31S=-\frac{1}{2}\cdot\ln\frac{1}{2}-\frac{1}{3}\cdot\ln\frac{1}{3}-2\cdot\frac{1}{6}\cdot\ln\frac{1}{6}\simeq 1.31 \botrule

So, the highest entropy is obtained for the text containing all the types with the same frequency. Such a text is hardly informative. The opposite case, with all the tokens being the same, obviously yields the zero entropy. Indeed, it contains a single piece of information. Two remaining examples require some effort to extract information from the text. However, we can speculate that such effort is lower in the third case (with S1.24similar-to-or-equals𝑆1.24S\simeq 1.24, given in boldface) comparing to the fourth one. Indeed, the third text most likely tells about A while in the fourth one we can hesitate between A and D. Of course, real-world practices are much more complicated as most frequent words are just function words (like articles or conjunctions). But if I read a text in a foreign language knowing only a dozen words and I spot there six hyenas, one hare, and one lion, then most probably this is a tale with a hyena as the main character. The latter example demonstrates to some extent the role of entropy in extracting relevant information from a text.

In the following subsections, two problems are analyzed with respect to a possibility to discriminate two different kinds of complex systems—texts and viral RNAs—using entropy as one of the parameters.

1 Measuring text comprehensibility

Here, I would like to mention a situation that convinced me of the role of entropy in text comprehensibility. With some previous results for several genres in Ukrainian when the belles-lettres appeared to have the lowest entropy compared, in particular, to journalistic and scientific texts[23], it was even easier to come to such a conclusion. A friend of mine, who is an Austrian quantitative linguist, asked for some routine assistance with a text written in a language I am fluent in. Upon throwing a glance at one of the passages of the original and its translation into Ukrainian, my mother tongue, I had a strange feeling that the former was more “readable”. This seemed really weird. So, I decided immediately to calculate the entropy of both versions—and indeed, it appeared higher for the Ukrainian translation. Obviously, this fact has nothing to do with languages as a whole but is related to the translator’s approach used.

Quantification of text comprehensibility is not an easy task as it involves a rather subjective estimation. This task becomes slightly simpler if a relative measure is sought for. Pursuing this aim, we have analyzed texts of a specific nature, namely, greetings from hierarchs of the Ukrainian Greek Catholic Church on the occasion of Christmas and Easter, the two most important Christian holidays[125]. Texts of such a kind are quite a typical subject of studies in quantitative linguistics [128, 129, 130].

Texts from three modern hierarchs were studied:444Texts of the greetings are accessible at the official websites http://ugcc.ua and https://ugcc.lviv.ua and eventually at other open resources. {itemlist}

Lubomyr Cardinal Husar M.S.U (Liubomyr Huzar, Любомир Гузар; *26.02.1933–†31.05.2017). He was Major Archbishop of Lviv in 2001–2005 and Major Archbishop of Kyiv and Halych in 2005–2011. The change in the title is due to the move of the see from Lviv to Kyiv.

Sviatoslav Shevchuk (Святослав Шевчук; *05.05.1970). His is the incumbent Supreme Archbishop of Kyiv and Halych, Head of the Ukrainian Greek Catholic Church since 2011.

Ihor Vozniak, C.SS.R. (Ihor Voznyak, Iгор Возьняк; *03.08.1952). He was Archbishop of the Lviv Archeparchy in 2005–2011, the Administrator of the Ukrainian Greek Catholic Church from February 10 to March 27, 2011, and is the incumbent Metropolitan of Lviv since 2011.

Messages from Cardinal Husar are generally easier to perceive, and there might be various reasons for this: vocabulary, style, syntax, etc. The trial and error method allowed to pick several parameters from the list given in \srefsec:Entropy+params that might serve quantifiers of text comprehensibility[125].

Length-related parameters (m1subscript𝑚1m_{1}, m2subscript𝑚2m_{2}, d𝑑d, and snsubscript𝑠𝑛s_{n}) were calculated using Eqs. (32)–(34) with xisubscript𝑥𝑖x_{i} being the word length in syllables, which is defined in Ukrainian very simply, as the number of letters for vowels \langleа, е, и, i, о, у, є, ї, ю, я\rangle [131]. Note that some function words can consist of consonants only (   1 0 0.24 1в [v] ‘in’,    1 0 0.24 1з [z] ‘with, from’, etc.) thus producing tokens of zero length.

The previously reported results[125] are supplemented here by Shevchuk’s and Vozniak’s greetings from 2018–2022. The original set of 36 texts was extended by 16 thus reaching 52 texts in the analysis presented here. The additions did not change the conclusions drawn in the preceding study.

A bit unexpected result is that length-related parameters do not seem to have any significant role in quantifying text comprehensibility, cf. \freffig:addresses_UGCC-p4-m2. This contradicts, for instance, a naïve expectation that shorter words are easier to perceive.

Refer to caption

Figure 8: Text of greetings parametrized by the fraction of four-syllabic words p4subscript𝑝4p_{4} and the dispersion of word lengths in syllables m2subscript𝑚2m_{2}. Mean values for the respective authors are marked with solid symbols. These are own results extending previously published work[125]

As one can see from Figs. 910, the studies texts demonstrate good separability with respect to entropy S𝑆S, the fraction of dis legomena N2/Nsubscript𝑁2𝑁N_{2}/N, and the h-point scaling coefficient a𝑎a. Note that the latter parameter was used for genre attribution by Zörnig et al.[126]. The fraction of dis legomena in an attribution role was our result[125].

The role of entropy as a discriminating parameter with respect to comprehensibility of texts is easily observed from the reported data: the lower the entropy the better comprehensibility. To a certain extent, one can think of a physical interpretation of such a result considering, for instance, a less “disordered” text to be easier to perceive. It is likely therefore that such “(dis)ordering” is reflected in the word frequency structure.

Refer to caption

Figure 9: Text of greetings parametrized by entropy S𝑆S and the fraction of dis legomena N2/Nsubscript𝑁2𝑁N_{2}/N. Mean values for the respective authors are marked with solid symbols. These are own results extending previously published work[125]

Refer to caption

Figure 10: Text of greetings parametrized by entropy S𝑆S and index a𝑎a. Mean values for the respective authors are marked with solid symbols. These are own results extending previously published work[125]

It should be stressed that weak or not separability of data with respect to some parameters just means they are not related to comprehensibility. Such parameters might still be useful for other purposes, for instance, in author attribution.

To complete this subsection, it might be interesting to establish a connection with one of the parameters related to comprehensibility and the “temperature” parameter discussed in Secs. 34. Indeed, the number of dis legomena can be expressed by \erefeq:Nj-exp:

N2=1z1e1/T1.subscript𝑁21superscript𝑧1superscript𝑒1𝑇1N_{2}=\frac{1}{z^{-1}e^{1/T}-1}. (35)

Considering the values of T1much-greater-than𝑇1T\gg 1 and z1similar-to-or-equals𝑧1z\simeq 1, we easily obtain in the leading order

N2T.similar-to-or-equalssubscript𝑁2𝑇N_{2}\simeq T. (36)

Note that the “temperature” parameter is dimensionless, so the above formula makes sense. This is an interesting and initially unexpected connection between two major approaches to the classification of complex systems considered in this Chapter.

2 RNA viruses, with focus on human coronaviruses

Now let us switch to a completely different subject of study, namely, to RNA viruses. This is done for the second time in this Chapter: previously, the “temperature” approach was discussed for mtDNA genomes in \srefsec:T-res. The “complete difference” between genomes and texts is, however, quite superficial: the former, as mentioned above in \srefsec:Genomes, can be considered within approaches rooted in linguistics. A major distinction between the two subjects is a possibility to justify the usage of entropy in quantifying comprehensibility of texts but virtually no chance to find a similar reasoning for rather abstractly defined nucleotide sequences in genomes.

Nonetheless, the study of mtDNA genomes revealed[79] a possibility to use entropy and some length-related parameters calculated for nucleotide sequences to distinguish certain mammalian family and genera, at least tentatively. Similar analysis was then done for viral RNAs[92]. Its partial results extended to cover some new material are reported below.

For nucleotide sequences defined at the end of \srefsec:Genomes (page 5), with the most frequent thymine (T) nucleotide serving as a space, it is possible to calculate a set parameters, of which I focus on entropy S𝑆S and dispersion m2subscript𝑚2m_{2} of mean token length m1subscript𝑚1m_{1}. In this case, lengths are measured as the number of nucleotides in the sequence but the empty sequence X is ascribed the zero length.

\tref

tab:viruses lists the results of calculations for coronaviruses (mostly human[132, 133]) being of particular interest in view of the recent COVID-19 pandemic[134] due to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The respective data are plotted on the (m2;S)subscript𝑚2𝑆(m_{2};S) plane in \freffig:viruses. Note that significant differences in the values of m1subscript𝑚1m_{1} compared to the ratio between the genome size and the number of tokens N𝑁N is due to high abundance of zero-length X tokens.

\tbl

Parameters for nucleotide sequences in human and some animal-related coronaviruses \topruleVirus size, bp N𝑁N S𝑆S m1subscript𝑚1m_{1} m2subscript𝑚2m_{2} sourceaa{}^{\text{a}} \colruleCCoV-HuPn 29086 9476 3.6914 2.0695 6.7500 MW591993.2 Feline a-CoV 29355 9588 3.7072 2.0617 6.4845 315192962 HCoV-229E 27317 9446 3.4910 1.8920 5.9998 12175745 HCoV-HKU1 29926 12002 3.0233 1.4935 3.7750 85667876 HCoV-NL63 27553 10806 3.0976 1.5499 4.0621 49169782 HCoV-OC43 30741 10931 3.4081 1.8124 5.5669 1578871709 MERS-CoV 30119 9800 3.7682 2.0735 6.4379 667489388 SARS-CoV 29751 9144 3.8944 2.2537 7.9013 30271926 SARS-CoV-2:    Reference 29903 9595 3.7307 2.1166 7.3059 NC_045512    Alpha 29763 9569 3.7264 2.1105 7.1738 OL546784.1    Beta 29827 9588 3.7281 2.1110 7.1925 MZ314998.1    Gamma 29809 9582 3.7270 2.1110 7.1920 2056248244    Delta (AY) 29769 9586 3.7232 2.1056 7.1238 OM269121.1    Delta1 (B.1) 29836 9590 3.7269 2.1113 7.2616 OK091006.1    Eta 29700 9554 3.7256 2.1088 7.1562 MZ362439.1    Iota 29714 9540 3.7271 2.1148 7.3563 MZ702250.1    Omicron (BA) 29752 9561 3.7296 2.1119 7.1738 OM283600.1    Omicron-1 29788 9578 3.7295 2.1101 7.1465 OM095411.1 \botrule {tabnote} aa{}^{\text{a}}Full source link is obtained by prefixing the listed sources with https://www.ncbi.nlm.nih.gov/nuccore/.

Refer to caption

Figure 11: Coronaviruses on the (m2,S)subscript𝑚2𝑆(m_{2},S) plane. Solid circles correspond to human coronaviruses and open circles denote animal-related ones. Red filling marks viruses with associated mild diseases while black is for severe diseases. Violet color is used for SARS-CoV-2 variants. The previously published results[92] are extended by new data

The worldwide circulation of numerous SARS-CoV-2 variants in 2020–2021 motivated the inclusion of its several strains and lineages in the analysis[135, 136]. The analyzed data also contain information about the canine coronavirus CCoV-HuPn-2018 recently discovered in a human patient [137], though with no human-to-human transmission reported. Feline coronavirus (Feline a-CoV, which is Feline infectious peritonitis virus) is given for future references.

The grouping of viruses on the (m2,S)subscript𝑚2𝑆(m_{2},S) plane in \freffig:viruses is quite interesting. We can observe that higher entropies (and higher length dispersion values) correspond to species causing more severe diseases. The respective domain, however, includes also the two analyzed animal-related coronaviruses yielding thus limitations for direct usage of such severity distinctions based on values of S𝑆S and m2subscript𝑚2m_{2}. Fortunately, we would have here false positive alerts for the feline and canine coronaviruses, not false negative.

Previously,[92] we have also reported that severity of diseases caused by coronaviruses strongly correlates with the kind of the most frequent two-nucleotide sequence. Namely, it contains two identical nucleotides for coronaviruses linked to mild diseases and two different nucleotides for MERS and two SARS coronaviruses. The abovementioned CCoV-HuPn-2018 belongs to the first group, with GG being the most frequent two-nucleotide sequence (similarly to the feline coronavirus). So, let us hope that it will not be associated with any serious disease whatsoever.

The grouping of SARS-CoV-2 variants is very clearly seen in \freffig:viruses. Such a result encourages the application of the suggested approach confirming in particular that the values of parameters are not just random, obtained upon deliberately chosen procedure of defining nucleotide sequences. One can expect such units to be another contribution in the linguistic analogies discussed in \srefsec:Genomes.

To conclude this Section, it might be interesting to mention that for nucleotide sequences discussed here rank–frequency distributions are essentially Zipfian, with wide plateaus at high ranks (low frequencies), thus indeed resembling words in natural languages. On the other hand, n-grams (to be specific, four-nucleotide chunks) in the studied genomes have qualitatively different rank–frequency distributions, closer to that of syllables[92], and the Yule distribution (4) yields proper description for them instead of Zipf’s law.

9 Final remarks

The kaleidoscope of problems presented in this Chapter has several things in common. First of all, the considered approaches are inspired by physical models but transferred onto very different domains, far beyond physics. In this way, the used terminology often lacks initial physical sense and is mostly employed by analogy. Occasionally, however, reminiscences from physics arise nodding toward the desired unity of laws to describe Nature at very different levels, no matter how pathetic it may sound.

The second point is the kind of analyzed systems generally falling under the complex system category. Linguistics, additionally to physics, is a cross-cutting subject here as properties of texts and languages are accompanied by genomes—but considered within a linguistic analogy. The only tools required for the studies of texts are a pen and a computer, which is the luxury a physicist can rarely afford, as even theoreticians need experimental data to substantiate their research.

Another common issue in all the considered problems is that the attempted parametrization and discrimination of systems based on the parameter values yield only rather fuzzy domains. But there is a simple reason behind such results: we consider complex systems describable by a plethora of variables having very different origins. Whenever a two-parametric classification is attempted, a projection from this many-dimensional space is made onto a two-dimensional plane. To make further steps, other tools, like multivariate discriminant analysis, should be utilized.

The approaches described in this Chapter should nevertheless be treated as auxiliary tools in the classifications of complex systems. I do hope that certain hints about systems’ properties and behavior might be obtained upon their applications, as was demonstrated by the example of language evolution, the quantification of text comprehensibility, and the analysis of RNA viral genomes. Further studies of other systems, the inclusion of new system types, and combinations of the developed techniques will decide.

References

  • 1. See, for instance, the list of works “Physicists’ papers on natural language from a complex systems viewpoint” at https://www.maths.usyd.edu.au/u/ega/physicist-language.
  • 2. H. A. Simon, Models of man: Social and rational. Mathematical essays on rational human behavior in society setting. Wiley, New York (1957).
  • 3. S. Golomb, Zipf’s law as a tool in strategic, military, and economic intelligence, IRE Prof. Group Antennas Propag. Newslett. 5(2), 7 (1962). 10.1109/MAP.1962.28058.
  • 4. P. Suppes, Probabilistic grammars for natural languages, Synthese. 22(1–2), 95–116 (1970). 10.1007/BF00413600.
  • 5. Y. Ijiri and H. A. Simon, Some distributions associated with Bose-Einstein statistics, Proc. Natl Acad. Sci. 72(5), 1654–1657 (1975). 10.1073/pnas.72.5.1654.
  • 6. B. J. West and J. Salk, Complexity, organization and uncertainty, Eur. J. Oper. Res. 30(2), 117–128 (1987). 10.1016/0377-2217(87)90088-9.
  • 7. G. Altmann, On the symbiosis of physicists and linguists, Rom. Rep. Phys. 60(3), 417–422 (2008).
  • 8. Y. Holovatch and V. Palchykov, Fox Mykyta and networks of language, J. Phys. Stud. 11(1), 22–33 (2007). 10.30970/jps.11.022. See also https://arxiv.org/abs/0705.1298.
  • 9. A. N. Vasilev, A. V. Chalyi, and I. V. Vasileva, About “exotic” problems of physics, Winnie the Pooh and Zipf’s law, J. Phys. Stud. 17(1), 1001 (2013). 10.30970/jps.17.1001.
  • 10. E. Rodriguez, M. Aguilar-Cornejo, R. Femat, and J. Alvarez-Ramirez, Scale and time dependence of serial correlations in word-length time series of written texts, Physica A. 414, 378–386 (2014). 10.1016/j.physa.2014.07.063.
  • 11. S. Eroglu, Menzerath–Altmann law: Statistical mechanical interpretation as applied to a linguistic organization, J. Stat. Phys. 157(2), 392–405 (2014). 10.1007/s10955-014-1078-8.
  • 12. R. H. Baayen, Word Frequency Distributions. Springer Science+Business Media, B.V., Dordrecht (2001).
  • 13. M. K. Anke Lüdeling, ed., Corpus Linguistics. vol. 2, Walter de Gruyter, Berlin (2009).
  • 14. I.-I. Popescu, G. Altmann, P. Grzybek, B. D. Jayaram, R. Köhler, V. Krupa, J. Mačutek, R. Pustet, L. Uhlířová, and M. N. Vidya, Word frequency studies. Mouton de Gruyter, Berlin–New York (2009).
  • 15. M. G. Kendall, The treatment of ties in ranking problems, Biometrika. 33(3), 239–251 (1945).
  • 16. A. Rovenchak, Where Alice meets Little Prince: Another approach to study language relationships, In eds. G. K. Mikros and J. Mačutek, Sequences in Language and Text, pp. 217–230. Mouton de Gruyter, Berlin–Boston (2015).
  • 17. A. Rovenchak. Models of frequency spectrum in texts based on quantum distributions in fractional space dimensions. In 20th International Conference on Control Systems and Computer Science CSCS 2015: Proceedings, 27-29 May 2015, Bucharest, Romania / Ed. by I. Dumitrache, A. M. Florea, F. Pop, and A. Dumitraşcu, vol. 2, pp. 645–649. IEEE Computer Society, Los Alamitos, CA (2015).
  • 18. M. Petruszewycz, L’histoire de la loi d’Estoup-Zipf : documents, Math. Sci. Hum. 44, 41–56 (1973).
  • 19. J. B. Estoup, Gammes sténographiques : méthode & exercices pour l’acquisition de la vitesse, 4e édn. Institut Sténographique de France, Paris (1916).
  • 20. E. U. Condon, Statistics of vocabulary, Science. 67(1733), 300 (1928). 10.1126/science.67.1733.300.
  • 21. G. K. Zipf, The Psychobiology of Language. Houghton Mifflin, New York (1935).
  • 22. G. K. Zipf, Human Behavior and the Principle of Least Effort. Addison-Wesley, Cambridge, MA (1949).
  • 23. S. N. Buk and A. A. Rovenchak, Rank–frequency analysis for functional style corpora of Ukrainian, J. Quant. Linguist. 11(3), 161–171 (2004). 10.1080/0929617042000314912.
  • 24. B. D. Jayaram and M. N. Vidya, Zipf’s law for Indian languages, J. Quant. Linguist. 15(4), 293–317 (2008). 10.1080/09296170802326640.
  • 25. A. Koplenig, Using the parameters of the Zipf–Mandelbrot law to measure diachronic lexical, syntactical and stylistic changes – a large-scale corpus analysis, Corpus Linguistics Linguistic Theory. 14(1), 1–34 (2018). doi:10.1515/cllt-2014-0049.
  • 26. A. Wei and H. Liu, Typological features of Zhuang from the perspective of word frequency distribution, Glottometrics. 44, 59–75 (2019).
  • 27. M. Gerlach, F. Font-Clos, and E. G. Altmann, Similarity of symbol frequency distributions with heavy tails, Phys. Rev. X. 6(2), 021009 (2016). 10.1103/PhysRevX.6.021009.
  • 28. Y. Holovatch, R. Kenna, and S. Thurner, Complex systems: physics beyond physics, Eur. J. Phys. 38(2), 023002 (2017).
  • 29. R. Ferrer i Cancho and R. V. Solé, Two regimes in the frequency of words and the origins of complex lexicons: Zipf’s law revisited, J. Quant. Linguist. 8(3), 165–173 (2001).
  • 30. L. Q. Ha, E. I. Sicilia-Garcia, J. Ming, and F. J. Smith. Extension of Zipf’s law to words and phrases. In Proc. 19th Intl Conf. Computat. Linguist., COLING ’02, pp. 315–320, Association for Computational Linguistics, Stroudsburg, PA, USA (2002). 10.3115/1072228.1072345.
  • 31. S. T. Piantadosi, Zipf’s word frequency law in natural language: A critical review and future directions, Psychon. Bull. Rev. 21(5), 1112–1130 (2014). 10.3758/s13423-014-0585-6.
  • 32. J. R. Williams, P. R. Lessard, S. Desu, E. M. Clark, J. P. Bagrow, C. M. Danforth, and P. S. Dodds, Zipf’s law holds for phrases, not words, Sci. Rep. 5, 12209 (2015). 10.1038/srep12209.
  • 33. A. Rovenchak and S. Buk, Part-of-speech sequences in literary text: Evidence from Ukrainian, J. Quant. Linguist. 25(1), 1–21 (2018).
  • 34. E. Arcaute, E. Hatna, P. Ferguson, H. Youn, A. Johansson, and M. Batty, Constructing cities, deconstructing scaling laws, J. R. Soc. Interface. 12(102) (2014). 10.1098/rsif.2014.0745.
  • 35. A. Ghosh, A. Chatterjee, A. S. Chakrabarti, and B. K. Chakrabarti, Zipf’s law in city size from a resource utilization model, Phys. Rev. E. 90(4), 042815 (2014). 10.1103/PhysRevE.90.042815.
  • 36. B. Jiang, J. Yin, and Q. Liu, Zipf’s law for all the natural cities around the world, Int. J. Geogr. Inf. Sci. 29(3), 498–522 (2015). 10.1080/13658816.2014.988715.
  • 37. D. H. Zanette, Zipf’s law and the creation of musical context, Musicae Scientiae. 10(1), 3–18 (2006). 10.1177/102986490601000101.
  • 38. M. Sheinman, A. Ramisch, F. Massip, and P. F. Arndt, Evolutionary dynamics of selfish DNA explains the abundance distribution of genomic subsequences, Sci. Rep. 6, 30851 (2016). 10.1038/srep30851.
  • 39. C. Furusawa and K. Kaneko, Zipf’s law in gene expression, Phys. Rev. Lett. 90, 088102 (2003). 10.1103/PhysRevLett.90.088102.
  • 40. H. Benisty, Simple wealth distribution model causing inequality-induced crisis without external shocks, Phys. Rev. E. 95, 052307 (2017). 10.1103/PhysRevE.95.052307.
  • 41. S. Aoki and M. Nirei, Zipf’s law, Pareto’s law, and the evolution of top incomes in the United States, Am. Econ. J. Macroecon. 9(3), 36–71 (2017).
  • 42. M. Mitzenmacher, A brief history of generative models for power law and lognormal distributions, Internet Math. 1(2), 226–251 (2004). 10.1080/15427951.2004.10129088.
  • 43. M. E. J. Newman, Power laws, Pareto distributions and Zipf’s law, Contemp. Phys. 46(5), 323–351 (2005). 10.1080/00107510500052444.
  • 44. M. V. Simkin and V. P. Roychowdhury, Re-inventing Willis, Phys. Rep. 502(1), 1–35 (2011). 10.1016/j.physrep.2010.12.004.
  • 45. A. N. Vasilev and I. V. Vasileva, Physics beyond physics: Application of physical approaches in quantitative linguistics, Ukr. J. Phys. 65(2), 143–150 (2020). 10.15407/ujpe65.2.143.
  • 46. R. Ferrer i Cancho and R. V. Solé, Zipf’s law and random texts, Adv. Complex Syst. 5(1), 1–6 (2002). 10.1142/S0219525902000468.
  • 47. R. Ferrer-i Cancho and B. Elvevåg, Random texts do not exhibit the real Zipf’s law-like rank distribution, PLoS ONE. 5(3), e9411 (2010). 10.1371/journal.pone.0009411.
  • 48. B. Mandelbrot, Mécanique statistique et théorie de l’information, C. r. hebd. séances Acad. sci. 232(18), 1638–1640 (1951).
  • 49. J. P. Ramos, R. J. Lopes, and D. Araújo, Interactions between soccer teams reveal both design and emergence: Cooperation, competition and Zipf-Mandelbrot regularity, Chaos Solitons Fractals. 137, 109872 (2020). 10.1016/j.chaos.2020.109872.
  • 50. M. A. Montemurro, Beyond the Zipf–Mandelbrot law in quantitative linguistics, Physica A. 300, 567–578 (2001).
  • 51. A. Rovenchak. Quantitative studies in the corpus of Nko periodicals. In eds. M. B. Arjuna Tuzzi and J. Mačutek, Recent Contributions to Quantitative Linguistics, pp. 125–138. Mouton de Gruyter, Berlin–Boston (2015).
  • 52. M. A. Montemurro. A generalization of the Zipf–Mandelbrot law in linguistics. In eds. M. Gell-Mann and C. Tsallis, Nonextensive Entropy: Interdisciplinary Applications, pp. 347–356. Oxford University Press (2004).
  • 53. C. Martindale, S. M. Gusein-Zade, D. McKenzie, and M. Y. Borodovsky, Comparison of equations describing the ranked frequency distributions of graphemes and phonemes, J. Quant. Linguist. 3, 106–112 (1996). 10.1080/09296179608599620.
  • 54. W. Li and P. Miramontes, Fitting ranked English and Spanish letter frequency distribution in US and Mexican presidential speeches, J. Quant. Linguist. 18, 359–380 (2011). 10.1080/09296174.2011.608606.
  • 55. A. Rovenchak, C. Riley, and T. Sherman, The Diary of Boima Kiakpomgbo from Mando Town (Liberia): A quantitative study of a Vai text, J. Quant. Linguist. 25(3), 271–287 (2018). 10.1080/09296174.2017.1373510.
  • 56. A. Wierzbicka, Semantics, Culture, and Cognition: Universal Human Concepts in Culture-Specific Configurations. Oxford University Press, New York–Oxford (1992).
  • 57. M. Yanakiev, Stilistika i ezikovo obuchenie [Stylistics and language training]. Narodna prosveta, Sofia (1977).
  • 58. O. V. Sokolova, Grammatika vozdeystviya: ¡¡infinitivnaya temperatura¿¿ v poéticheskikh, reklamnykh i PR-tekstakh [grammar of influence: “infinitive temperature” in poetic, advertising and pr-texts], Izv. Samarskogo nauchnogo tsentra Ross. akad. nauk. 14(2(5)), 1301–1308 (2012).
  • 59. B. Mandelbrot. An informational theory of the statistical structure of languages. In ed. W. Jackson, Proceedings of Symposium on Applications of Communication Theory, pp. 486–502, Butterworth Scientific Publications, London (1953).
  • 60. K. Kosmidis, A. Kalampokis, and P. Argyrakis, Statistical mechanical approach of human language, Physica A. 366, 495–502 (2006). 10.1016/j.physa.2005.10.039.
  • 61. S. Miyazima and K. Yamamoto, Measuring the temperature of texts, Fractals. 16, 25–32 (2008). 10.1142/S0218348X08003776.
  • 62. M.-C. Chang, A. C.-C. Yang, H. E. Stanley, and C.-K. Peng, Measuring information-based energy and temperature of literary texts, Physica A. 468, 783–789 (2017). 10.1016/j.physa.2016.11.106.
  • 63. A. Rovenchak and S. Buk, Application of a quantum ensemble model to linguistic analysis, Physica A. 390(7), 1326–1331 (2011). 10.1016/j.physa.2010.12.009.
  • 64. A. Rovenchak and S. Buk, Defining thermodynamic parameters for texts from word rank-frequency distributions, J. Phys. Stud. 15(1), 1005 (2011). 10.30970/jps.15.1005.
  • 65. S. Roy, A. Banerjee, S. Sanyal, D. Ghosh, and R. Sengupta, A study on Raga characterization in Indian classical music in the light of MB and BE distribution, J. Phys.: Conf. Ser. 1896(1), 012007 (2021). 10.1088/1742-6596/1896/1/012007.
  • 66. V. I. Yukalov, Modified semiclassical approximation for trapped Bose gases, Phys. Rev. A. 72(3), 033608 (2005). 10.1103/PhysRevA.72.033608.
  • 67. S. Buk and A. Rovenchak. Probing the “temperature” approach on Ukrainian texts: Long-prose fiction by Ivan Franko. In eds. E. Kelih, R. Knight, J. Mačutek, and A. Wilson, Studies in Quantitative linguistics 23: Issues in Quantitative Linguistics 4, pp. 160–175. RAM-Verlag, Lüdenscheid (2016).
  • 68. A. Rovenchak, Trends in language evolution found from the frequency structure of texts mapped against the Bose-distribution, J. Quant. Linguist. 21(3), 281–294 (2014).
  • 69. J. P. Tuldava, Problemy i metody kvantitativno-sistemnogo issledovaniya leksiki [Problems and methods of quantitative-systemic studies of vocabulary]. Valgus, Tallinn (1987).
  • 70. The National Center for Biotechnology Information. https://www.ncbi.nlm.nih.gov.
  • 71. Ensembl. http://www.ensembl.org.
  • 72. The Human Protein Atlas. http://www.proteinatlas.org.
  • 73. G. Gamow, Possible relation between deoxyribonucleic acid and protein structures, Nature. 173(4398), 318 (1954). 10.1038/173318a0.
  • 74. G. Gamow, Possible mathematical relation between deoxyribonucleic acid and proteins, Biol. Meddel. Kongel. Danske Vidensk. Selsk. 22(3), 1–13 (1954).
  • 75. G. Gamow, Information transfer in the living cell, Sci. Am. 193(4), 70–79 (1955).
  • 76. V. Nanjundiah, George Gamow and the genetic code, Resonance. 9(7), 44–49 (2004).
  • 77. J. D. Watson and F. H. C. Crick, Genetical implications of the structure of deoxyribonucleic acid, Nature. 171(4361), 964–967 (1953). 10.1038/171964b0.
  • 78. E. Schrödinger, What Is Life? The Physical Aspect of the Living Cell. Cambridge University Press, Cambridge (1944).
  • 79. A. Rovenchak, Telling apart Felidae and Ursidae from the distribution of nucleotides in mitochondrial DNA, Mod. Phys. Lett. B. 32(5), 1850057 (2018).
  • 80. B. Alberts, A. Johnson, J. Lewis, M. Raff, K. Roberts, and P. Walter, Molecular Biology of the Cell, sixth edn. Garland Science, New York, NY (2015).
  • 81. S. K. Sessions. Genome size. In Brenner’s Encyclopedia of Genetics, pp. 301–305. Elsevier (2013). 10.1016/b978-0-12-374984-0.00639-2.
  • 82. J.-W. Taanman, The mitochondrial genome: structure, transcription, translation and replication, Biochim. Biophys. Acta. 1410(2), 103–123 (1999). 10.1016/S0005-2728(98)00161-3.
  • 83. J. Wang, S. Li, Y. Zhang, H. Zheng, Z. Xu, J. Ye, J. Yu, and G. K.-S. Wong, Vertebrate gene predictions and the problem of large genes, Nat. Rev. Genet. 4(9), 741–749 (2003). 10.1038/nrg1160.
  • 84. A. Schneider and D. Ebert, Covariation of mitochondrial genome size with gene lengths: Evidence for gene length reduction during mitochondrial evolution, J. Mol. Evol. 59(1) (2004). 10.1007/s00239-004-2607-x.
  • 85. S. Kunugi, Proteins as Polymers and Polyelectrolytes, In eds. S. Kobayashi and K. Müllen, Encyclopedia of Polymeric Nanomaterials, pp. 1–6. Springer, Berlin–Heidelberg (2014). 10.1007/978-3-642-36199-9_167-1.
  • 86. V. Brendel, J. S. Beckmann, and E. N. Trifonov, Linguistics of nucleotide sequences: Morphology and comparison of vocabularies, J. Biomol. Struct. Dyn. 4, 011–021 (1986).
  • 87. E. N. Trifonov, Z. Volkovich, and Z. M. Frenkel, Multiple levels of meaning in DNA sequences, and one more, Ann. N. Y. Acad. Sci. 1267(1), 35–38 (2012). 10.1111/j.1749-6632.2012.06589.x.
  • 88. S. Ji, The linguistics of DNA: Words, sentences, grammar, phonetics, and semantics, Ann. N. Y. Acad. Sci. 870, 411–417 (1999). 10.1111/j.1749-6632.1999.tb08916.x.
  • 89. S. Ji. The molecular linguistics of DNA: Letters, words, sentences, texts, and their meanings. In Theoretical Information Studies, pp. 187–231 (2020). 10.1142/9789813277496_0010.
  • 90. R. N. Mantegna, S. V. Buldyrev, A. L. Goldberger, S. Havlin, C.-K. Peng, M. Simons, and H. E. Stanley, Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics, Phys. Rev. E. 52(3), 2939–2950 (1995). 10.1103/PhysRevE.52.2939.
  • 91. Homo sapiens mitochondrial DNA, complete genome, isolate: NDsq0220. https://www.ncbi.nlm.nih.gov/nuccore/AP008824.1.
  • 92. M. Husev and A. Rovenchak, On the verge of life: Distribution of nucleotide sequences in viral RNAs, Biosemiotics. 14(2), 253–269 (2021). 10.1007/s12304-021-09403-5.
  • 93. The Anglo-Saxon Version of The Gospel of John; the page is archived at https://web.archive.org/web/20150507015011/http://wordhord.org/nasb/john.html.
  • 94. A. Rovenchak, Statystyka Boze i drobovi statystyky v teoriji bahatočastynkovykh system i sumižnykh zadačakh [Bose-statistics and fractional types of statistics in the many-body theory and related problems]. Lviv University Press, Lviv (2019).
  • 95. ISO 639-3. https://iso639-3.sil.org.
  • 96. J. H. Greenberg, A quantitative approach to the morphological typology of language, Int. J. Am. Linguist. 26(3) (1960). 10.1086/464575.
  • 97. M. Husev and A. Rovenchak, Parametrization of rank-frequency distributions of nucleotide sequences in virus RNAs, Visn. Lviv Univ. Ser. Phys. 58, 72–84 (2021). 10.30970/vph.58.2021.72.
  • 98. C. Tsallis, What are the numbers that experiments provide?, Química Nova. 17(6), 468–471 (1994).
  • 99. S. Abe and Y. Okamoto, eds., Nonextensive Statistical Mechanics and Its Applications. Springer, Berlin (2001). 10.1007/3-540-40919-X.
  • 100. C. Tsallis, Introduction to Nonextensive Statistical Mechanics: Approaching a Complex World. Springer, New York (2009). 10.1007/978-0-387-85359-8.
  • 101. P. Douglas, S. Bergamini, and F. Renzoni, Tunable Tsallis distributions in dissipative optical lattices, Phys. Rev. Lett. 96(11), 110601 (2006). 10.1103/PhysRevLett.96.110601.
  • 102. T. Ochiai and J. C. Nacher, On the construction of complex networks with optimal Tsallis entropy, Physica A. 388(23), 4887–4892 (2009). 10.1016/j.physa.2009.07.049.
  • 103. P. Zhao, J. Pan, Q. Yue, and J. Zhang, Pricing of financial derivatives based on the Tsallis statistical theory, Chaos Solitons Fractals. 142, 110463 (2021). 10.1016/j.chaos.2020.110463.
  • 104. G. Kaniadakis, Non-linear kinetics underlying generalized statistics, Physica A. 296, 405–425 (2001). 10.1016/S0378-4371(01)00184-4.
  • 105. G. Kaniadakis, Theoretical foundations and mathematical formalism of the power-law tailed statistical distributions, Entropy. 15(10), 3983–4010 (2013). 10.3390/e15103983.
  • 106. T. Wada and A. M. Scarfone, Information geometry on the κ𝜅\kappa-thermostatistics, Entropy. 17(3), 1204–1217 (2015). 10.3390/e17031204.
  • 107. G. Kaniadakis, M. M. Baldi, T. S. Deisboeck, G. Grisolia, D. T. Hristopulos, A. M. Scarfone, A. Sparavigna, T. Wada, and U. Lucia, The ϰ-statistics approach to epidemiology, Sci. Rep. 10, 19949 (2020). 10.1038/s41598-020-76673-3.
  • 108. S. L. E. F. da Silva, G. Z. dos Santos Lima, E. V. Volpe, J. M. de Araújo, and G. Corso, Robust approaches for inverse problems based on Tsallis and Kaniadakis generalised statistics, Eur. Phys. J. Plus. 136(5), 518 (2021). 10.1140/epjp/s13360-021-01521-w.
  • 109. U. M. S. Costa, M. L. Lyra, A. R. Plastino, and C. Tsallis, Power-law sensitivity to initial conditions within a logisticlike family of maps: Fractality and nonextensivity, Phys. Rev. E. 56(1), 245–250 (1997). 10.1103/PhysRevE.56.245.
  • 110. A. Nakamichi, I. Joichi, O. Iguchi, and M. Morikawa, Non-extensive galaxy distributions – Tsallis statistical mechanics, Chaos Solitons Fractals. 13(3), 595–601 (2002). 10.1016/S0960-0779(01)00042-X.
  • 111. R. Cerqueti, G. Rotundo, and M. Ausloos, Tsallis entropy for cross-shareholding network configurations, Entropy. 22(6), 676 (2020). 10.3390/e22060676.
  • 112. C. Truesdell, The Tragicomical History of Thermodynamics 1822–1854. Springer, New York (1980).
  • 113. D. Styer, Entropy as disorder: History of a misconception, Phys. Teach. 57(7), 454–458 (2019). 10.1119/1.512682.
  • 114. R. Clausius, Ueber verschiedene für die Anwendung bequeme Forman der Hauptgleichungen der mechanischen Wärmetheorie, Ann. Phys. Chem. 125(7), 353–400 (1865).
  • 115. L. Boltzmann, Über die Beziehung zwischen dem zweiten Hauptsatze der mechanischen Wärmetheorie und der Wahrscheinlichkeitsrechnung respektive den sätzen über das Wärmegleichgewicht, Sitzungsber. Kaiserl. Akad. Wiss. Math.-Naturwiss. Cl. (Abt. 2). 76, 373–435 (1877). Quoted via: Wissenschaftliche Abhandlungen von Ludwig Boltzmann; herausg. von F. Hasenöhrl. II. Band, pp. 164–223. Barth, Leipzig (1909).
  • 116. M. Planck, Ueber das Gesetz der Energieverteilung im Normalspectrum, Ann. Phys. 309, 553–563 (1901).
  • 117. J. W. Gibbs, Elementary Principles in Statistical Mechanics. Charles Scribner’s Sons, New York, NY (1902).
  • 118. L. Benguigui, The different paths to entropy, Eur. J. Phys. 34(2), 303–321 (2013). 10.1088/0143-0807/34/2/303.
  • 119. C. E. Shannon, A mathematical theory of communication, Bell Syst. Tech. J. 27(3), 379–423 (1948). 10.1002/j.1538-7305.1948.tb01338.x.
  • 120. C. E. Shannon, A mathematical theory of communication, Bell Syst. Tech. J. 27(4), 623–656 (1948). 10.1002/j.1538-7305.1948.tb00917.x.
  • 121. I. James, Claude Elwood Shannon. 30 April 1916 — 24 February 2001 (Obituary), Biogr. Mems Fell. R. Soc. 55, 257–265 (2009). 10.1098/rsbm.2009.0015.
  • 122. B. El-Haik and K. Yang, The components of complexity in engineering design, IIE Trans. 31, 925–934 (1999). 10.1023/A:1007650829429.
  • 123. Y. You, Entropy and Coding, In Audio Coding: Theory and Applications, pp. 145–160. Springer US, Boston (2010). 10.1007/978-1-4419-1754-6_8.
  • 124. I. Müller and W. H. Müller, Fundamentals of Thermodynamics and Applications: With Historical Annotations and Many Citations from Avogadro to Zermelo. Springer, Berlin–Heidelberg (2009).
  • 125. A. Rovenchak and O. Rovenchak, Quantifying comprehensibility of Christmas and Easter addresses from the Ukrainian Greek Catholic Church hierarchs, Glottometrics. 41, 57–66 (2018).
  • 126. P. Zörnig, E. Kelih, and L. Fuks, Classification of Serbian texts based on lexical characteristics and multivariate statistical analysis, Glottotheory. 7(1), 41–66 (2016). 10.1515/glot-2016-0004.
  • 127. E. Kelih, G. Antić, P. Grzybek, and E. Stadlober, Classification of author and/or genre? The impact of word length, In eds. C. Weihs and W. Gaul, Classification – The Ubiquitous Challenge, pp. 498–505. Springer, Heidelberg (2005).
  • 128. Z. Dai and H. Liu, Quantitative analysis of Queen Elizabeth II’s and American Presidents’ Christmas messages over 50 years (1967–2018), Glottometrics. 45, 63–88 (2019).
  • 129. M. Kubát, J. Mačutek, and R. Čech, Communists spoke differently: An analysis of Czechoslovak and Czech annual presidential speeches, Digit. Scholarsh. Humanit. 36(1), 138–152 (2021). 10.1093/llc/fqz089.
  • 130. X. Jiang, Y. Jiang, and C. K. W. Hoi, Is Queen’s English drifting towards common people’s English? — Quantifying diachronic changes of Queen’s Christmas messages (1952–2018) with reference to BNC, J. Quant. Ling. 29(1), 1–36 (2022). 10.1080/09296174.2020.1737483.
  • 131. J. Mačutek and A. Rovenchak. Canonical word forms: Menzerath–Altmann law, phonemic length and syllabic length. In eds. E. Kelih, V. Levickij, and Y. Matskulyak, Studies in Quantitative Linguistics 11: Issues in Quantitative Linguistics 2, pp. 136–147. RAM-Verlag, Lüdenscheid (2011).
  • 132. S. Su, G. Wong, W. Shi, J. Liu, A. C. K. Lai, J. Zhou, W. Liu, Y. Bi, and G. F. Gao, Epidemiology, genetic recombination, and pathogenesis of coronaviruses, Trends Microbiol. 24(6), 490–502 (2016). 10.1016/j.tim.2016.03.003.
  • 133. F. Wu, S. Zhao, B. Yu, Y.-M. Chen, W. Wang, Z.-G. Song, Y. Hu, Z.-W. Taoa, J.-H. Tian, Y.-Y. Pei, M.-L. Yuan, Y.-L. Zhang, F.-H. Dai, Y. Liu, Q.-M. Wang, J.-J. Zheng, L. Xu, E. C. Holmes, and Y.-Z. Zhang, A new coronavirus associated with human respiratory disease in China, Nature. 579, 265–269 (2020). 10.1038/s41586-020-2008-3.
  • 134. M. Ciotti, M. Ciccozzi, A. Terrinoni, W.-C. Jiang, C.-B. Wang, and S. Bernardini, The COVID-19 pandemic, Crit. Rev. Clin. Lab. Sci. 57(6), 365–388 (2020). 10.1080/10408363.2020.1783198.
  • 135. Tracking SARS-CoV-2 variants. https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/.
  • 136. SARS-CoV-2 variant classifications and definitions https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-classifications.html.
  • 137. A. N. Vlasova, A. Diaz, D. Damtie, L. Xiu, T.-H. Toh, J. S.-Y. Lee, L. J. Saif, and G. C. Gray, Novel canine coronavirus isolated from a hospitalized patient with pneumonia in East Malaysia, Clin. Infect. Dis. 74(3), 446–454 (2022). 10.1093/cid/ciab456.