References

Dynamics of Wolbachia pipientis gene expression across the Drosophila melanogaster life cycle.

Author for correspondence:
Casey M. Bergman
Faculty of Life Sciences
University of Manchester
Michael Smith Building
Oxford Road
Manchester, M13 9PT
United Kingdom
casey.bergman@manchester.ac.uk

Abstract

Symbiotic interactions between microbes and their multicellular hosts have manifold impacts on molecular, cellular and organismal biology. To identify candidate bacterial genes involved in maintaining endosymbiotic associations with insect hosts, we analyzed genome-wide patterns of gene expression in the $\alpha$-proteobacteria Wolbachia pipientis across the life cycle of Drosophila melanogaster using public data from the modENCODE project that was generated in a Wolbachia-infected version of the ISO1 reference strain. We find that the majority of Wolbachia genes are expressed at detectable levels in D. melanogaster across the entire life cycle, but that only 7.8% of 1195 Wolbachia genes exhibit robust stage- or sex-specific expression differences when studied in the “holo-organism” context. Wolbachia genes that are differentially expressed during development are typically up-regulated after D. melanogaster embryogenesis, and include many bacterial membrane, secretion system and ankyrin-repeat containing proteins. Sex-biased genes are often organized as small operons of uncharacterized genes and are mainly up-regulated in adult Drosophila males in an age-dependent manner suggesting a potential role in cytoplasmic incompatibility. Our results indicate that large changes in Wolbachia gene expression across the Drosophila life-cycle are relatively rare when assayed across all host tissues, but that candidate genes to understand host-microbe interaction in facultative endosymbionts can be successfully identified using holo-organism expression profiling. Our work also shows that mining public gene expression data in D. melanogaster provides a rich set of resources to probe the functional basis of the Wolbachia-Drosophila symbiosis and annotate the transcriptional outputs of the Wolbachia genome.

Keywords: Wolbachia, Drosophila, gene expression, symbiosis, development

Background

Intracellular bacterial symbioses provide powerful systems to investigate the diverse consequences of coevolution between microbes and their hosts. Some bacterial endosymbiotic interactions are beneficial to both organisms, resulting in coadapations that generate mutual dependency. These obligate symbioses are often characterized by ancient phylogenetic associations, restriction of microbes to specialized host cells, provision of essential nutrients from microbe to host, and microbial genome reduction (reviewed in Dale and Moran (2006); Moran et al. (2008)). Other microbial endosymbiotic interactions are obligate for the microbe, but are non-essential (“facultative”) from the standpoint of the host. Facultative bacterial symbioses are typically more short-lived evolutionarily and microbial effects on hosts are not always beneficial (Dale and Moran, 2006; Moran et al., 2008). For example, the $\alpha$-proteobacteria Wolbachia pipientis is often found in facultative associations with many arthropod species, inducing a range of host effects from reproductive parasitism to viral protection (reviewed in Zug and Hammerstein (2015)). In fact, even within a single host species such as Drosophila melanogaster, closely-related variants of the same Wolbachia lineage can lead to either mutualistic or pathogenic interactions (Min and Benzer, 1997; Chrostek et al., 2013). Facultative endosymbionts are of particular interest since some may represent a transitional state between free-living bacteria and obligate mutualists, thus offering insights into both the early evolutionary stages of mutualism and the propagation of invasive pathogens (Dale and Moran, 2006; Moran and Degnan, 2006).

Efforts to identify microbial genes that maintain infections of facultative endosymbionts are hampered by the inability to culture and manipulate these species in a free-living state. Likewise, the lack of extreme genome reduction in facultative endosymbionts does not allow the mere existence of a gene to provide prima facie evidence of its importance in a particular host context, as it does in mutualist species with highly reduced genomes (Moran and Degnan, 2006). Therefore, candidate genes in facultative endosymbionts that might mediate interaction with their hosts have been primarily identified using comparative genomic approaches. For example, sequencing of the first Wolbachia genome from D. melanogaster (wMel) revealed an unusually large number ankyrin repeat domain (ANK) encoding genes relative to other bacteria (Wu et al., 2004). Large numbers of ANK-containing genes are also observed in the genomes of other Wolbachia strains that form facultative associations with arthropod hosts (Iturbe-Ormaetxe et al., 2005; Duron et al., 2007; Siozios et al., 2013), while few ANK-containing genes are found in the obligate Wolbachia endosymbionts of nematodes (Foster et al., 2005; Darby et al., 2012). Comparative genomic analysis of more closely-related strains of Wolbachia has also been used to identify candidate genes involved in host-symbiont interaction (Iturbe-Ormaetxe et al., 2005; Sinkins et al., 2005; Duron et al., 2007; Chrostek et al., 2013; Woolfit et al., 2013). For example, a cluster of eight genes (called the Octomom region), identified as being specifically amplified in the pathogenic “Popcorn” (wMelPop) strain of Wolbachia from D. melanogaster (Chrostek et al., 2013; Woolfit et al., 2013), was recently shown to cause the high bacterial titres and virulence associated with this strain (Chrostek and Teixeira, 2015).

Genome-wide gene expression profiling offers an alternative approach to identify candidate genes involved in host-symbiont interactions. Both transcriptomic and proteomic approaches have been used to study how bacterial gene regulation changes in native host tissues for obligate endosymbionts (Wilcox et al., 2003; Moran et al., 2005; Reymond et al., 2006; Bennuru et al., 2011; Darby et al., 2012; Rao et al., 2012; Luck et al., 2014). However, genome-wide expression profiling has not yet been used extensively to study gene expression dynamics for facultative endosymbionts in their native host context (Slatko et al., 2014). Recently, Darby et al. (2014) conducted transcriptomic and proteomic analysis of a Wolbachia strain from D. melanogaster (wMelPop-CLA) and Baldridge et al. (2014) profiled the proteome of Wolbachia wStr from the planthopper Laodelphax striatellus, both stably transinfected into non-native host cell lines from the mosquito Aedes albopictus. Likewise, two recent studies have used wMelPop-CLA transinfected in non-native Aedes cell lines to identify small non-coding RNAs (ncRNAs) by high-throughput sequencing (Mayoral et al., 2014; Woolfit et al., 2015). Woolfit et al. (2015) also generated transcriptomic data from two Wolbachia strains (wMelPop and wMelCS) in native host tissues (heads of D. melanogaster), but did not attempt to identify differentially-expressed genes that may be involved in host-microbe interactions.

Here we report global gene expression dynamics for a facultative endosymbiont across the life cycle of a native arthropod host, taking advantage of a previously uncharacterized Wolbachia infection in the reference strain that was used for the D. melanogaster genome project. We show that the D. melanogaster ISO1 reference strain was originally infected with Wolbachia prior to being donated to the Drosophila stock center, where after it was used by the modENCODE project to generate deep total RNA-seq data from 30 time points across the D. melanogaster life cycle including embryos, larvae, pupae, adult males, and adult females (Graveley et al., 2011; Brown et al., 2014; Duff et al., 2015). Using this rich transcriptomic resource, we show that the majority of Wolbachia genes are expressed across the life cycle, but that most Wolbachia genes show stable expression across different host stages and sexes when studied at the whole-fly level. We identify a set of 80 genes that show reproducible changes in expression levels in at least one life-cycle stage, the majority of which are up-regulated after embryonic development with peaks of expression in early larval, late pupal or adult stages. We also identify 41 genes that show expression differences between males and females, with the majority of these sex-biased genes being up-regulated in males and showing age-dependent effects. Genes with stage- or sex-specific expression differences include chaperones, ANK-containing genes, and genes with predicted membrane or secretion system function, but most have no known function. Our results provide general insight into the dynamics of gene expression in a facultative endosymbiont across life-cycle stages and sexes of an arthropod host, and provide a set of resources to further explore the functional basis of the model Wolbachia-Drosophila symbiosis.

Results and Discussion

The D. melanogaster ISO1 reference strain is infected with Wolbachia

As a control for another project, we obtained the ISO1 reference strain (Brizuela et al., 1994) used for the D. melanogaster genome project from the Bloomington Drosophila Stock Center (BDSC) and sequenced its genome. We discovered that the BDSC ISO1 sample contained a large number of Wolbachia sequences (4.5 million reads, 2.5% of total) when mapped against a “holo-genome” comprised of the D. melanogaster plus W. pipientis wMel reference genomes (Adams et al., 2000; Wu et al., 2004). The observation of Wolbachia sequences in the ISO1 stock was unexpected, since at no point since its original sequencing by the Berkeley Drosophila Genome Project (BDGP) and Celera Genomics in 2000 had Wolbachia sequences been reported in this strain (Adams et al., 2000; Celniker et al., 2002; Hoskins et al., 2015). In fact, direct searches of assembled or unassembled ISO1 sequences from the BDGP failed to detect any evidence of Wolbachia (Wu et al., 2004; Salzberg et al., 2005).

We investigated the cause of the discrepancy of Wolbachia sequences in the BDGP and BDSC ISO1 genomic data by first establishing the provenance of these lineages. As documented in their database, the BDSC ISO1 sub-strain was donated directly to the stock center by Jim Kennison in 1994. The ISO1 sub-strain used by the BDGP was obtained from Gerry Rubin’s lab in the late 1990’s (Roger Hoskins, personal communication). The Rubin lab ISO1 sub-strain was obtained in the mid-1990s from Jim Kennison via at least one intermediate lab (Todd Laverty, personal communication). Thus, in contrast to naive assumptions, the BDSC ISO1 sub-strain is neither a direct descendant nor progenitor of the ISO1 sub-strain used in the D. melanogaster genome project, and these two sub-strains have had independent trajectories since at least 1994.

The presence of Wolbachia sequences in our genomic data, but not in BDGP genomic data, could be explained in a number of ways. For example, the BDGP ISO1 sub-strain could have lost its infection, or Wolbachia sequences could have been eliminated during nuclear enrichment steps that were used to reduce mitochondrial DNA in the original Sanger sequencing libraries (Roger Hoskins, personal communication) (Adams et al., 2000). Though less likely because horizontal transfer of Wolbachia has not been observed in D. melanogaster but spontaneous loss is relatively common (Hoffmann et al., 1998; Richardson et al., 2012), the ISO1 sub-strain could alternatively have acquired a Wolbachia infection in the BDSC, where many stocks are known to be infected (Clark et al., 2005). To resolve when and where the BDSC ISO1 sub-strains lost (or acquired) its Wolbachia infection, we obtained ISO1 sub-strains from three additional sources: (i) the original sub-strain, maintained continuously by Jim Kennison since its synthesis in 1986; (ii) the sub-strain used for the Drosophila genome project, maintained by the BDGP since the late 1990’s; and (iii) a sub-strain maintained by Gerry Rubin’s lab since the mid-1990’s, which was the progenitor of the BDGP sub-strain. The Rubin lab sub-strain was never treated for a Wolbachia infection using antibiotics (Gerry Rubin, personal communication). We performed diagnostic PCR for Wolbachia on all four ISO1 sub-strains before and after tetracycline treatment. We found that the ISO1 sub-strains from Jim Kennison’s lab and the BDSC were infected with Wolbachia, but those from the Rubin lab and the BDGP were not (data not shown). Amplification of Wolbachia sequences was only observed in flies before antibiotic treatment, indicating that the source of Wolbachia DNA sequences is not due to nuclear integration, which occurs rarely in D. melanogaster (Huang et al., 2014). We conclude that the original ISO1 strain synthesized by Kennison was infected with Wolbachia, that an infected ISO1 sub-strain was donated by Kennison to the BDSC in 1994, and that an ISO1 sub-strain that was cured of (or spontaneously lost) its infection was obtained by the Rubin lab and donated to the BDGP. These results also show that, in addition to a high proportion of lab stocks carrying Wolbachia (Clark et al., 2005), sub-lines of the same D. melanogaster stock may vary in their Wolbachia infection status.

After confirming that the BDSC ISO1 sub-strain is indeed infected with Wolbachia, we next addressed which of the major lineages of Wolbachia segregating in D. melanogaster infects this strain (Richardson et al., 2012; Chrostek et al., 2013; Woolfit et al., 2013). To do this, we assembled a consensus sequence from ISO1 reads that mapped to the wMel reference and generated a whole-genome phylogeny jointly with the wMel reference genome (Wu et al., 2004) and genomes from known Wolbachia genotypes (Chrostek et al., 2013). This analysis showed that the Wolbachia infection in the BDSC ISO1 sub-strain is from a wMel-like genotype that is very closely related to both the wMel reference genome sequence (Wu et al., 2004) and the wMel type strain recently reported by Chrostek et al. (2013) (Figure 1A). The very close relationship between the wMel genotype in ISO1 and the wMel reference genome allows functional genomic data collected in ISO1 to be easily and accurately mapped to the reference genome sequence, and for reference genome annotations to closely reflect the content of the ISO1 Wolbachia genome.

The modENCODE developmental time-course reveals global stability in Wolbachia gene expression across the D. melanogaster life cycle

Establishing that the BDSC ISO1 sub-strain is infected with Wolbachia is important since this strain is widely used in Drosophila genomics, including being one of the strains used by modENCODE to profile the transcriptome of D. melanogaster (Graveley et al., 2011; Brown et al., 2014; Duff et al., 2015). In particular, modENCODE generated total RNA-seq libraries from BDSC ISO1 that span 30 time points across the D. melanogaster life cycle including multiple stages from embryos, larvae, pupae, and both adult sexes, with two biological replicates being available for 24 of the 30 time points (Graveley et al., 2011; Brown et al., 2014; Duff et al., 2015). We emphasize that the modENCODE total RNA-seq libraries were made from whole organisms, and thus any tissue-specific differences in Wolbachia gene expression will be averaged, as will sex-specific differences in non-adult stages. We tested whether the Wolbachia infection in ISO1 could be detected in modENCODE total RNA-seq libraries by mapping reads to the combined D. melanogaster plus W. pipientis holo-genome reference. We found that the modENCODE total RNA-seq libraries do contain large numbers of Wolbachia sequences, with a median of 1.7 million reads per sample (range: 0.1-7 million) mapping to the Wolbachia genome, corresponding to a median of 1.6% (range: 0.3%-8.5%) of the total number of RNA-seq reads mapped in each sample (Supplemental File 1). As shown in Figure 1B, coverage and strand-specificity of the modENCODE RNA-seq dataset is high enough to show clear correspondence with the boundaries of the majority of annotated Wolbachia gene models, given their presumed operonic structure and lack of annotated untranslated regions. These results further confirm that the BDSC ISO1 sub-strain is indeed infected with Wolbachia, allowing (and also requiring) the modENCODE RNA-seq developmental time course to be analyzed in the context of the Wolbachia-Drosophila symbiosis.

We next counted reads and estimated expression levels in transcripts per million (TPM) for each of the 1195 characterized protein-coding genes in the Wolbachia genome in each of the modENCODE RNA-seq samples (Supplemental File 2). At least 948 (79.3%) Wolbachia genes were expressed (defined as having non-zero TPM estimates) across all stages and replicates (Supplemental File 1). Using the more stringent definition of $\geq 2$ mapped reads per gene used by Darby et al. (2014), more Wolbachia genes can be detected as being expressed in each sample from the modENCODE whole-organism RNA-seq data set ($>$856 genes, $>$71.6% of total) than could be detected by these authors using combined transcriptomic and proteomic profiling of Wolbachia wMelPop-CLA expression in cell culture (66.8%). The two samples with the lowest percentage of expressed genes were also among those with the fewest total reads, and both had many more expressed genes in the biological replicate from the same stage (Embryos 22-24 hr: 948 vs 1111, Embryos 12-14 hr: 994 vs 1112, Supplemental File 1), indicating they may be outliers with respect to the actual number of genes expressed because of low sequencing coverage. The median number of genes expressed (non-zero TPM) across all samples is 1110, indicating that the majority of the Wolbachia genome is transcriptionally active throughout the D. melanogaster life cycle.

To provide an initial view of how Wolbachia gene expression changes across the D. melanogaster life-cycle, we measured the correlation of expression levels (in TPMs) across all Wolbachia genes between all pairs of samples in the modENCODE total RNA-seq time course (Figure 2). Correlation among biological replicates of the same stage is very high ($r>0.94$) and highly significant ($p<2.2e-16$). The lowest correlation among biological replicates is observed for three stages from the third larval instar (L3 dark blue gut, L3 light blue gut and L3 clear gut), which show higher similarity between stages from the same replicate series than they do between biological replicates from the same stage. Correlation of expression levels is also reasonably high and highly significant among all life-cycle stages ($r>0.61$, $p<2.2e-16$). However, two weakly-differentiated, partially-overlapping clusters can be observed that span embryonic to white prepupal (WPP) stages, and late larval to adult stages, respectively (square blocks of yellow spanning multiple stages in Figure 2). Stage-specific clusters for embryonic 10-12 hours, larval L1, larval L2, and larval L3 samples, respectively, can also be observed in addition to the larger embryonic/pupal and pupal/adult clusters. Overall, these results suggest that differences in Wolbachia gene expression do exist among D. melanogaster life-cycle stages, but that the global pattern of Wolbachia gene expression does not change dramatically across the D. melanogaster life cycle when assayed at the level of the whole organism.

Given the availability of an essentially-complete Wolbachia developmental transcriptome, we can now ask if gene expression levels can be predicted based on the codon usage bias of protein-coding genes in a facultative endosymbiont like Wolbachia, as has been assumed in the past (Wu et al., 2004). We find that Wolbachia shows no significant correlation between levels of transcription measured in transcripts per million (TPM) and effective number of codons ($N_{c}$) at any D. melanogaster life-cycle stage (Supplemental Figure 1). Thus, despite global stability in expression across the host life-cycle, Wolbachia genes have not optimized their codon usage bias to reflect levels of transcription, nor does it appear that Wolbachia gene expression levels are globally adapted to any particular host life-cycle stage. These results are consistent with the lack of association between codon bias and expression levels in other pathogenic and obligate endosymbionts (Andersson and Sharp, 1996; Palacios and Wernegreen, 2002; Herbeck et al., 2003; Rispe et al., 2004), and may reflect the inefficacy of selection on codon usage in the low effective population sizes expected in endosymbionts, or the reduced number of tRNA genes in the Wolbachia genome (Chan and Lowe, 2009). Alternatively, this result could imply that Wolbachia uses extensive post-transcriptional regulation to modulate protein expression levels, as has recently been reported in Buchnera (Hansen and Degnan, 2014).

A small subset of Wolbachia genes show dynamic expression across the D. melanogaster life cycle

We next used the 24 stages in the modENCODE time-course that have biological replicates to identify Wolbachia genes whose expression varies in a reproducible manner across the D. melanogaster life cycle. Because of the large number of life-cycle stages and their complex developmental dependencies, an analysis involving all-by-all pairwise comparisons was deemed unfeasible. Instead, we used an omnibus test of changes in expression across all stages simultaneously using an ANOVA-like GLM approach (McCarthy et al., 2012). This analysis revealed a small subset of Wolbachia genes (80/1195, 6.7%) that are differentially expressed in one or more life-cycle stage at an adjusted p-value of less than 0.05 (Figure 3, Supplemental File 2). All 80 genes have a greater than two-fold change between at least one pair of stages. The vast majority of Wolbachia genes identified as differentially expressed across the D. melanogaster life cycle in the modENCODE time-course show a common pattern of being expressed at lower relative levels in embryos (75/80, 93.8%), with higher expression in either larval, pupal and/or adult stages, and a transient decrease in expression at larval L3 (12 hrs). However, 5 genes show the opposite pattern of having higher relative expression in embryos with down-regulation later in the life cycle. The dynamics of up-regulated and down-regulated genes show nearly complementary transitions at the end of embryogenesis, suggesting response to common signals or possible cross-talk between these gene sets. We note that both up- and down-regulated genes exhibit a wide range of absolute expression levels, and many show quantitative shifts rather than dramatic qualitative changes in expression level (Supplemental Figure 2).

To support conclusions about the global pattern of Wolbachia gene expression dynamics across the D. melanogaster life cycle based on differential expression analysis, we also performed probabilistic clustering on the entire modENCODE RNA-seq time course (including stages without replicates) (Si et al., 2014) . This analysis identified two main clusters that could be matched across independent clustering runs (Supplemental Figure 3A). The first cluster contains the majority of Wolbachia genes (1033, 86.4%) and shows a pattern of relatively stable expression levels across the life cycle (Supplemental Figure 3B). The second cluster contains the remaining 162 genes (13.6%) and includes the vast majority of genes identified as differentially expressed in the life-cycle GLM (74/80, 92.5%). Only 6 genes (GroES/WD0308, ABC transporter/WD0455, succinate dehydrogenase subunit/WD0727, WD0804, DnaK/WD0928, Hsp90/WD1277) identified as differentially expressed in the life-cycle GLM were not found in cluster 2 and are instead merged together with the stably-expressed genes in cluster 1, most of which (with the exception of succinate dehydrogenase subunit/WD0727) are all in the small, down-regulated class of differentially-expressed genes.

Closer inspection of the number of runs in which a gene was assigned to cluster 2 revealed two distinct sub-clusters (Supplemental Figure 3A), both of which show up-regulation after embryogenesis. The first, which we call cluster 2a, shows modest up-regulation after embryogenesis with the characteristic dip in expression at larval L3 (12 hrs) for a set of 103 genes, and includes a substantial proportion (22/75, 29.7%) of the up-regulated genes identified in the life-cycle GLM (Supplemental Figure 3C and D). The second, cluster 2b, shows stronger up-regulation for 59 genes and the dip in expression at larval L3 (12 hrs), including the majority of both up-regulated classes identified in the life-cycle GLM (52/75, 70.3%) (Supplemental Figure 3E and F). Overall, these clustering results support the main conclusions of the differential expression analysis that only a small proportion of Wolbachia genes show robust differences in expression across the modENCODE life-cycle time course at the level of the whole organism, and that the majority of dynamically-expressed genes show up-regulation after embryogenesis. However, the greater number of genes identified in cluster 2 relative to those identified by the life-cycle GLM suggests that our differential expression analysis may have only detected a conservative subset of Wolbachia genes that show the strongest expression differences across D. melanogaster development.

Dynamically-expressed Wolbachia genes are predicted to be involved in stress response and host-microbe interactions

The 80 Wolbachia genes that exhibit dynamic expression across the modENCODE D. melanogaster life-cycle time course fall into three broad classes (Figure 3). The first is a small class of 5 genes that show high relative expression in embryos with down-regulation later in the life cycle. Three of these genes are involved in chaperone function (GroES/WD0308, DnaK/WD0928, and Hsp90/WD1277). The chaperone GroEL/WD0307, which putatively forms a complex with GroES/WD0308, is co-transcribed with GroES/WD0308 and shows similar down-regulation at later stages of the life cycle, but does not pass the significance threshold in the life-cycle GLM (adjusted p-value=0.15). Both GroES/WD0308 and GroEL/WD0307 are in top 15 most abundant transcripts based on average TPM across all stages, confirming that chaperones are among the most highly expressed genes in Wolbachia (Bennuru et al., 2011; Darby et al., 2012, 2014). High basal expression of GroEL or other chaperone proteins was suggested to be a compensatory mechanism for the accumulation of slightly deleterious non-synonymous mutations in endosymbionts that arise because of their small populations size and lack of recombination (Moran, 1996; Fares et al., 2002). The differential expression of Wolbachia chaperones during the D. melanogaster life cycle that we observe may result from different exposure to external sources of stress or different requirements for protein folding/stability between eggs and larvae versus pupae and adults.

The second class, comprising the majority of up-regulated genes detected (57/80), shows increases in relative expression starting with the larval L1 or L2 stages carrying on into adulthood, with decreases at the larval L3 (12 hr) stage and increases at the white pre-pupal 2 and 3 day stages. Genes in this class are mostly unannotated, but include eight genes that code for proteins with membrane or secretion system function (WspB/WD0009, TerC/WD0194, SPFH domain/WD0482, type II secretion/WD0500, HlyD/WD0649, type I secretion/WD0770, VirB3/WD0859, Rhoptry surface protein related/WD1041) and four ANK-containing genes (WD0191, WD0385, WD0438, WD1213). ANK-containing genes from several bacterial species have been shown to be type IV secretion system effector molecules that have diverse effects on eukaryotic cells (Caturegli et al., 2000; Sisko et al., 2006; Lin et al., 2007; Pan et al., 2008; O’Brien et al., 2015). Thus, these results suggest secretion of ANK-containing genes into the host cell may be enriched during early larval and mid-to-late pupal stages of D. melanogaster development. Up-regulation of components for secretion systems (type III) has been observed in pupal stages for other arthropod endosymbionts (Dale et al., 2002), suggesting that metamorphosis may be a general period that is enriched for up-regulation of secreted symbiont effector proteins involved in host interaction. The presence of a homologue for the E. coli transcriptional regulator DksA/WD1094 in this class also provides a potential mechanism to understand the common differential regulation of these genes (Paul et al., 2005; Costanzo et al., 2008).

A third class of 22 Wolbachia genes show up-regulation primarily in D. melanogaster adults, with higher expression in adult males relative to adult females at the same age (see more below). Most of the genes in this class are also unannotated, however three are ANK-containing genes (WD0291, WD0292, WD0438). Our observation of sex-specific expression of ANK-containing genes based on global gene expression profiles of Wolbachia in D. melanogaster extends results from targeted RT-PCR analysis in Wolbachia strains from other insects (Sinkins et al., 2005; Duron et al., 2007; Klasson et al., 2009; Papafotiou et al., 2011; Wang et al., 2014), and provides further evidence for their possible involvement in cytoplasmic incompatibility. Finally, we note that our qualitative classification of up-regulated genes in classes 2 and 3 is not mutually exclusive, and the existence of four genes (WD0438, WD1288, WD1289 and WD1290) with sex-biased expression that also show differential expression at larval or pupal stages suggests possible shared regulation of these classes.

RT-qPCR supports patterns of Wolbachia gene expression inferred from whole organism RNA-seq

We validated the major pattern of Wolbachia gene expression dynamics between embryos and adults based on RNA-seq by performing reverse-transcriptase real-time quantitative PCR (RT-qPCR) for a sample of 10 genes in the BDSC ISO1 sub-strain. To assess if our findings were restricted to only one specific host strain, we also performed RT-qPCR for the same genes as well as in a second D. melanogaster strain (w1118) that carries a wMel genotype very closely related to the one infecting ISO1 (see Figure 1A) (Chrostek et al., 2013). Three Wolbachia genes that were not identified as differentially expressed were chosen as reference genes (WD1043, Wsp/WD1063, petB/WD1071) on the basis of a low fold-change and low coefficient of variation across the RNA-seq time course. One of these (WD1063) is Wsp, the most highly expressed gene in the wMel genome that has been used previously as a control for RT-qPCR-based expression analysis in Wolbachia (Papafotiou et al., 2011). We chose five genes that were up-regulated after embryogenesis (WspB/WD0009, WD0061, WD0830, WD0837, WD1289) and two genes that were down-regulated after embryogenesis (groES/WD0308, Hsp90/WD1277) to validate results of the GLM-based RNA-seq differential expression analysis. We performed RT-qPCR on 16-18 hr old embryos, 1-day post-eclosion males, and 1-day post-eclosion virgin females. We measured relative expression levels normalized to the average expression in embryonic samples of the three stably-expressed genes.

As shown in Figure 4, RT-qPCR in both ISO1 and w1118 broadly confirmed that genes predicted to be stably-expressed based on RNA-seq do not change substantially in relative expression from embryonic to adult stages, whereas both up-regulated and down-regulated genes do, and in the same direction and relative magnitude as predicted by the RNA-seq analysis. Generalized linear modelling of RT-qPCR expression levels for ISO1 and w1118 separately revealed more genes with significant differences between embryos and adults in w1118 (upregulated: 5/5 validated; down-regulated: 2/2 validated) than in ISO1 (upregulated: 4/5 validated; down-regulated: 1/2 validated) (Supplemental File 3). We also detected slight but significant differences in RT-qPCR expression between embryos and adults for two genes in the “stable” class in w1118 (Wsp/WD1063, petB/WD1071), which are not observed in ISO1.

To increase overall power and to separate gene-specific from strain-specific effects, we analysed RT-qPCR data for both strains together in a single GLM (Supplemental File 3). This joint analysis revealed that all seven genes predicted to be up- or down-regulated based on RNA-seq in ISO1 were confirmed as differentially expressed between embryos and adults using RT-qPCR. Differential expression was observed for all genes in both sexes with the exception of Hsp90/WD1277, which only showed significant differences between embryos and males. Genes predicted to be stably-expressed are also confirmed, with the exception of WD1043 which shows a slight, but marginally significant up-regulation in males versus embryos. Overall, we conclude that RT-qPCR results validate the Wolbachia gene expression dynamics inferred from whole-organism RNA-seq in D. melanogaster, and that gene expression information from the ISO1 RNA-seq time course can likely be extrapolated to other strains carrying wMel-like Wolbachia infections.

Wolbachia genes with sex-biased expression show age-dependent effects

As Wolbachia is known to cause a variety of sex-specific phenotypes on its hosts (Werren et al., 2008), including cytoplasmic incompatibility in D. melanogaster (Hoffmann, 1988), we performed a more detailed analysis of Wolbachia expression between males and females at matched ages. For this analysis, we used an exact testing framework (Robinson and Smyth, 2008) because the GLM-based approach used for the complete life cycle is not the optimal method to use in a pairwise context. We identified a total of 41 genes that exhibited greater than 1.5-fold difference at an adjusted p-value cutoff of 0.01 in pairwise tests between male and female samples at either 1, 5 or 30 days post-eclosion, respectively (Figure 5, Supplemental File 2). Most sex-biased genes in this analysis were identified in one or both of the up-regulated classes in the life-cycle GLM above (28/41, 68.3%), indicating these complementary approaches identify a similar set of Wolbachia genes with detectable sex-biased expression in the modENCODE data set. Likewise, sex-biased genes comprise over one-third of differentially-expressed genes identified in the life-cycle GLM (28/80, 35%), suggesting that sex-biased expression is a dominant component of major differences in Wolbachia gene expression that can be observed across the D. melanogaster life cycle. Neither the GLM nor pairwise analysis revealed sex-biased expression in D. melanogaster for homologs of Wolbachia genes from Culex pipiens (WD0631, WD0632; WD0254, WD0255, WD0508, WD0622, WD0623, WD0626) that have recently been suggested to play a role in cytoplasmic incompatibility (Beckmann and Fallon, 2013; Pinto et al., 2013).

Many Wolbachia male-biased genes identified in either the life-cycle GLM or male-vs-female pairwise analyses are found consecutively in the genome in small clusters (WD0061–WD0062, WD0291–WD0292, WD0763–WD0764, WD0837–WD0838, WD0973–WD0975, WD1269–WD1270 and WD1288–WD1290), suggesting that they might be co-transcribed as operons (see example in Figure 1B). Visual inspection confirmed that six out of seven of these clusters (WD0061–WD0062, WD0291–WD0292, WD0837–WD0838, WD0973–WD0975, WD1269–WD1270 and WD1288–WD1290) are on the same strand and co-transcribed as operons based on contiguous mapping of RNA-seq reads between genes (Supplemental Figure 4). The remaining cluster (WD0763–WD0764) corresponds to two divergently-transcribed genes whose co-regulation may represent transcription from a common promoter region. While operon structure is predicted to be common in the Wolbachia genome (Pertea et al., 2009; Dehal et al., 2010; Taboada et al., 2012; Mao et al., 2014), the detection of sex-biased expression for individual genes in the same operon mutually reinforces that these genes are truly differentially expressed, and suggests common functionality of the genes in these as-yet uncharacterized loci.

The majority of sex-biased genes in the pairwise male-vs-female analyses showed higher expression in males relative to females at matched stages, with only 7 genes (rluC/WD0415, uppS/WD0527, sodium/alanine symporter/WD1047, WD1056, WD1261, cation antiporter subunit G/WD1301, WD1304) showing relatively higher expression in females at one or more time point. Additionally, most genes with sex-biased expression were identified at 5 days post-eclosion (35/41), many of which maintained sex-biased expression until 30 days post-eclosion. Whole-organism RNA-seq at 5 days post-eclosion correctly predicted the presence (3/3) or lack (13/14) of sex-biased expression differences for 16/17 ANK-containing genes in a wMel strain previously classified by RT-qPCR to have over 1.5-fold difference in expression level between testes and ovaries of 2-day old flies (Papafotiou et al., 2011) (the only exception being that WD0292 shows sex-biased expression in the RNA-seq data at 5-days that is not observed in the RT-qPCR at 2-days). The general lack of sex-biased expression at 1-day post-eclosion inferred from RNA-seq is also supported by our RT-qPCR results (Figure 4). The five up-regulated genes we tested using RT-qPCR are all sex-biased at 5-days but not 1-day post-eclosion (Figure 5), none of which show sex-biased expression at 1-day post-eclosion in the RT-qPCR data.

Our finding that Wolbachia genes with sex-biased expression also show age-dependent effects is consistent with a decline in the strength of cytoplasmic incompatibility reported in males at 1-day versus 5-day post eclosion in D. melanogaster (Reynolds and Hoffmann, 2002; Reynolds et al., 2003; Yamada et al., 2007). The observed pattern of sex-biased genes being up-regulated in older males is compatible with these Wolbachia genes playing a role in attenuating the modification of D. melanogaster sperm that leads to embryonic lethality in incompatible crosses (Poinsot et al., 2003). Alternatively, if the host is responsible for reducing the effects of Wolbachia on the sperm of older males, up-regulation of Wolbachia genes in older males could represent a compensatory effect and hence indicate these genes play a role in promoting cytoplasmic incompatibility.

wMel genes with dynamic expression in D. melanogaster are conserved in other Wolbachia strains

To identify if candidate genes identified on the basis of differential expression in D. melanogaster might interact more broadly with other hosts, we asked whether wMel genes that show stage- and sex-specific expression are conserved in other divergent Wolbachia strains. For this analysis, we used complete Wolbachia genome sequences from wRi (an arthropod supergroup A strain from D. simulans), wPip-Pel (an arthropod supergroup B strain from Culex quinquefasciatus) and wBm (a nematode supergroup D strain from Brugia malayi) (Klasson et al., 2008, 2009; Foster et al., 2005). We identified and clustered homologs in all genomes analyzed, and reconstructed homology groups that included wMel homologs for 86 of 93 genes that show either stage- or sex-specific expression (7 dynamically-expressed wMel genes were too small to pass BLAST filtering cutoffs). Only 3 of the 86 dynamically-expressed genes in homology groups (3.5%) were restricted to the wMel genome, whereas 30 genes (34.9%) had homologs in Wolbachia genomes from other arthropods, and a further 53 genes (61.6%) also had homologs in Wolbachia genomes from nematodes. The phylogenetic distribution of dynamically-expressed genes does not differ from genome-wide expectations (${\chi}^{2}=4.82,p=0.09,d.f.=2$). These results indicate that the majority of genes identified as dynamically expressed in D. melanogaster are core components of the Wolbachia gene repertoire and are not unusual in their degree of conservation. Nevertheless, many dynamically-expressed candidate genes are arthropod-specific and few are D. melanogaster-specific, as might be expected for a facultative endosymbiont that can switch arthropod hosts by horizontal transfer. Arthropod-specific dynamically-expressed genes include several ANK-containing genes (WD0191, WD0636, WD1213) and membrane/secretion system genes (ABC transporter/WD0455, SPFH domain/WD0482, type II secretion/WD0500, sodium/alanine symporter/WD1047, ClpA/WD1237), emphasizing the importance of inter-cellular communication in explaining how Wolbachia forms facultative symbioses with its arthropod hosts.

Expression of Wolbachia genes previously implicated in host-microbe interaction

In addition to identifying genes that are candidates for mediating host-microbe interaction on the basis of their stage- or sex-specific differential expression, we also investigated expression levels of Wolbachia genes previously suggested to be candidates for mediating interaction with D. melanogaster. The most-widely hypothesized set of candidates for host-microbe interaction are the 23 ANK-containing genes that are possible type IV secretion system effectors in Wolbachia (Wu et al., 2004; Iturbe-Ormaetxe et al., 2005; Papafotiou et al., 2011; Siozios et al., 2013), which the modENCODE data show are expressed at widely different levels in D. melanogaster (Figure 6A). The five most weakly-expressed ANK-containing genes (WD0285, WD0286, WD0514, WD0636, WD0637) are found in the Octomom and prophage regions, and are the same five genes which Papafotiou et al. (2011) found were expressed too weakly to obtain reliable RT-qPCR data in adult gonads. Thirteen ANK-containing genes are highly expressed (WD0191, WD0291, WD0292, WD0294, WD0385, WD0438, WD0441, WD0498, WD0550, WD0633, WD0754, WD0766, WD1213), which include the majority of ANK genes identified as differentially expressed in this study or by Papafotiou et al. (2011) (WD0191, WD0291, WD0292, WD0294, WD0385, WD0438, WD0550, WD0636, WD1213). The nine genes that make a complete type IV secretion system in the wMel are all highly expressed in all stages, including the virB8 paralog (WD0817) which is not a part of the two genomic clusters that contain the remaining eight type IV secretion system genes. These results support a model where a functionally competent type IV Wolbachia secretion system is expressed throughout the D. melanogaster life cycle, with both constitutive and regulated secretion of subsets of ANK-containing effectors.

The Octomom region is part of the accessory genome of Wolbachia (Iturbe-Ormaetxe et al., 2005; Chrostek et al., 2013) and contains eight genes whose copy number controls Wolbachia growth and pathogenesis (Chrostek and Teixeira, 2015). In the wMel variant where Octomom is present in one copy, all genes in this region (WD0507–WD0514) are expressed at relatively constant levels across the life cycle (Figure 6B). None of these genes show a significant change in gene expression during host development in the life-cycle GLM. However, different Octomom genes do vary considerably in their expression levels relative to each other, with the most highly expressed genes being found in the middle of this interval (WD0509–WD0512). Given that two genes with possible regulatory (the helix-turn-helix containing gene WD0508) or effector (the ANK-containing gene WD0514) function are relatively weakly expressed in the non-pathogenic wMel variant, it is possible that over-expression of one or both of these genes may be responsible for the pathogenic phenotype when Octomom is amplified in wMelPop (Chrostek and Teixeira, 2015).

Unlike obligate endosymbionts with streamlined genomes, prophages are often present in Wolbachia from arthropod hosts and have been suggested to directly or indirectly influence Wolbachia-host interactions (Kent and Bordenstein, 2010; Metcalf et al., 2014). Two major prophage regions are present in the wMel genome — called WO-A and WO-B — both of which have undergone degeneration and rearrangement since insertion (Wu et al., 2004; Kent et al., 2011). There is no clear evidence that the WO-A and WO-B prophages from wMel can enter a lytic phase as they can in other arthropods (Masui et al., 2001; Fujii et al., 2004; Bordenstein et al., 2006; Sanogo and Dobson, 2006), however phage-like particles have been reported in extracts of D. melanogaster strains infected with wMel (Gavotte et al., 2004). Consistent with previous results from wMelPop-CLA (Darby et al., 2014) and prophages in Salmonella enterica (Perkins et al., 2009), expression levels of most genes in the WO-A and WO-B prophage regions are typically very low across the entire D. melanogaster life cycle (Figure 6C and D), and define the largest segments of the wMel genome with consecutive lowly-expressed genes Supplemental Figure 5). The most conspicuous exception to this pattern is the 21-gene interval in WO-B (WD0611–WD0634) that contains genes laterally-transferred between Wolbachia and the Rickettsia endosymbiont of the tick Ixodes scapularis (WD0612–WD0621) (Ishmael et al., 2009; Gillespie et al., 2012), a region not typically present in WO prophage from other Wolbachia strains (Kent et al., 2011). In addition, two very abundant anti-sense ncRNA transcripts can be detected overlapping the major capsid genes of both WO-A (WD0274) and WO-B (WD0604) (Supplemental Figure 6), which may play a role in the regulation of prophage genes.

Most prophage-encoded structural genes are expressed at low levels, with only genes in the tail (WD0567–WD0575) and base-plate (WD0638–WD0644) regions of WO-B being expressed at appreciable levels. Likewise, most non-structural prophage-encoded genes previously suggested to be candidates for host interaction (VrlC.2/WD0579, VrlC.1/WD0580, Patatin/WD0565, DNA methylases WD0263 and WD0594) (Kent and Bordenstein, 2010) are expressed at low levels. Intriguingly, each prophage region contains a highly-expressed operon (WD0267–WD0269 in WO-A and WD0599–WD0600 in WO-B) that encodes homologs of the E. coli RelE toxin (WD0269 and WD0600) (Figure 6C and D). RelE is a stress-inducible cytotoxic translational repressor that is counter-acted by the antitoxin RelB, a small protein which gene is co-transcribed in the same operon as RelE (Christensen et al., 2001; Pedersen et al., 2003; Yamaguchi et al., 2011). The genes adjacent to the RelE homologues in WO-A and WO-B (WD0267, WD0268 and WD0599) are also co-transcribed and encode small peptides, and thus could be acting as antitoxins. In fact, WD0268–WD0269 and WD0599–WD0600 have been computationally predicted to be toxin-antitoxin (TA) pairs (Shao et al., 2011), and TA pairs have been previously reported in other cryptic prophages (Van Melderen and Saavedra De Bast, 2009). RelE-containing gene clusters are also found in similar positions (between the terminase and portal genes that form the phage head) in divergent prophages from D. simulans (WOriA) and N. vitripinnis (WOVitA2) (Kent et al., 2011), further indicating they may play some conserved functional role such as stabilizing the Wolbachia prophage genomic regions by preventing large-scale deletions (Van Melderen and Saavedra De Bast, 2009). Low expression levels of phage structural genes, together with highly-expressed putative TA pairs suggests that prophage in wMel are maintained the lysogenic state by self-preservation.

Conclusions

We have shown that the ISO1 reference strain used by the modENCODE project is infected with Wolbachia, and used this fortuitous observation to study the global expression dynamics of a facultative endosymbiont over the life cycle of the model insect species, D. melanogaster. Our work represents the most comprehensive gene expression profiling to date of an endosymbiotic bacteria in its native host context. We establish that most Wolbachia genes are expressed in all D. melanogaster life-cycle stages, but that major changes in expression levels of Wolbachia genes are rare when studied simultaneously across all D. melanogaster tissues. Additional work is needed to rule out lack of power to detect real differences due to the low number of replicates and averaging of tissue-specific expression in our study, but global stability in Wolbachia expression is mechanistically consistent with the limited number of regulatory genes encoded in the wMel genome (Wu et al., 2004). Global stability of Wolbachia gene expression across the D. melanogaster life-cycle may be an adaptive response that simply reflects the stable environment of an intracellular endosymbiont, or that suggests Wolbachia co-exists in non-obligatory symbioses largely in a stable “stealth mode” that reduces the chances of being detected by the host as a pathogen.

Nevertheless, a set of 93 Wolbachia wMel genes that show robust stage- or sex-specific differential expression can be identified at the whole-fly level, many of which share common expression dynamics and therefore may be co-regulated. These genes provide many new candidate genes for understanding, and possibly manipulating, the genetic basis of how Wolbachia interacts with arthropod hosts. Furthermore, differences in expression levels among Wolbachia genes previously implicated to mediate host-symbiont interaction can provide insight into the likelihood and mechanistic basis of existing candidates. Importantly, we also provide the first detailed insight into the developmental dynamics of Wolbachia gene expression in an insect host, which suggest larval and pupal stages (where Wolbachia have been detected cytologically (Clark et al., 2005)) merit further study to understand how Wolbachia manipulates host biology to maintain persistent infections and affect transmission.

Future studies can leverage our finding that the modENCODE total RNA-seq dataset contains a nearly-complete Wolbachia transcriptome to functionally annotate the transcriptional landscape of the Wolbachia genome. Currently, only protein-coding regions and a small number of ncRNAs are included in the wMel genome annotation, and recent work has identified a handful of additional Wolbachia ncRNAs (Mayoral et al., 2014; Woolfit et al., 2015). The strand-specific total RNA-seq data from the modENCODE can now be used to generate high-quality transcript models to annotate 5’ and 3’ untranslated regions, operons and identify new ncRNA genes in Wolbachia (see examples in Supplemental Figures 4 and 6). The possibility of a more comprehensive annotation of ncRNAs in Wolbachia is particularly exciting given recent work suggesting ncRNAs provide an important layer of post-transcriptional regulation to modulate protein expression levels in the Buchnera endosymbiont of aphids (Hansen and Degnan, 2014). Together with other recently published transcriptomic data (Darby et al., 2014; Mayoral et al., 2014; Woolfit et al., 2015), the necessary materials are now available to systematically reannotate the Wolbachia wMel genome in order to support basic and applied research on this important model organism.

Methods

D. melanogaster strains and husbandry

Sub-strains of the D. melanogaster ISO1 strain originally described in Brizuela et al. (1994) were obtained from several sources: (i) the Bloomington Drosophila Stock Center (BDSC ISO1, stock #2057); (ii) Jim Kennison (National Institute of Child Health and Human Development); (ii) Todd Laverty (Howard Hughes Medical Institute Janelia Farms); and (iv) Sue Celniker (Lawrence Berkeley National Laboratory). The DrosDel w1118 isogenic line carrying Wolbachia variant wMel (hereafter “w1118”) is described in Chrostek et al. (2013). D. melanogaster lines were maintained on standard cornmeal diet at a constant temperature of 25$\mathrm{\SIUnitSymbolCelsius}$.

We generated versions of all ISO1 sub-strains cured of any potential Wolbachia infection by treating with tetracycline for two generations. Adults were allowed to lay eggs for 5 days on Formula 4-24 food (Carolina, cat #173210) mixed with equal part water containing $0.25\text{\,}\mathrm{\SIUnitSymbolMicro g}$/$\text{\,}\mathrm{mL}$ tetracycline. Offspring from the first generation were collected on day 10 and transferred to new food containing $0.25\text{\,}\mathrm{\SIUnitSymbolMicro g}$/$\text{\,}\mathrm{mL}$ tetracycline and allowed to lay eggs for 5 days. Offspring from the second generation were collected on day 10 and transferred onto standard cornmeal-agar food to establish Wolbachia-free stocks.

Wolbachia infection status

DNA for PCR screening of Wolbachia infection status was prepared from single flies by placing individual males in a standard fly squish buffer ($50\text{\,}\mathrm{\SIUnitSymbolMicro L}$ of 1M Tris pH 8.0, 0.5M EDTA, 5M NaCl) plus $1\text{\,}\mathrm{\SIUnitSymbolMicro L}$ of $10\text{\,}\mathrm{m}\mathrm{g}\mathrm{/}\mathrm{m}\mathrm{l}$ Proteinase K. Flies were then placed in a thermocycler at 37$\mathrm{\SIUnitSymbolCelsius}$ for 30 minutes, 95$\mathrm{\SIUnitSymbolCelsius}$ for 2 minutes followed by a 4$\mathrm{\SIUnitSymbolCelsius}$ hold. $4\text{\,}\mathrm{\SIUnitSymbolMicro L}$ of fly squish product was used in a $50\text{\,}\mathrm{\SIUnitSymbolMicro L}$ PCR. The presence of Wolbachia was confirmed by PCR using two sets of primers: (i) Wolbachia_F2 (5’ TGGCTCACATAGATGCTGGT 3’) and Wolbachia_R2 (5’ GTCCCATTTCTCACGCATTT 3’); and (ii) Wolbachia_F3 (5’ ATCCTGCAAATTGGCGTACT 3’) and Wolbachia_R3 (5’ ATAACGCACACCTGGCAAAT 3’). To ensure DNA preparation was sufficient for PCR amplification, control primers were used from the D. melanogaster genome: rDNA-F (5’ AAACTAGGATTAGATACCCTATTAT 3’) and rDNA-R (5’ AAGAGCGACGGGCGATGTGT 3’). PCR was performed with Kappa HiFi polymerase (KAPA Biosystems, KK2502) using the following reaction conditions: 30 cycles of 95$\mathrm{\SIUnitSymbolCelsius}$ for 20 seconds, 60$\mathrm{\SIUnitSymbolCelsius}$ for 15 seconds, 72$\mathrm{\SIUnitSymbolCelsius}$ for 90 seconds.

Genome sequencing and data analysis

Genomic DNA for the BDSC ISO1 strain was prepared from 10 starved, adult males using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, 69504). $1\text{\,}\mathrm{\SIUnitSymbolMicro g}$ of DNA from each was fragmented using a Covaris S220 sonicator (Covaris Inc.) to 250 base pair (bp) fragments by adjusting the treatment time to 85 seconds. Following manufacturer’s directions, short fragment libraries were made using the KAPA Library Preparation Kits (KAPA Biosystems, KK8201) and Bioo Scientific NEXTflex DNA Barcodes (Bioo Scientific, 514104). The resulting libraries were purified using Agencourt AMPure XP system (Beckman Coulter, A63880), then quantified using a Bioanalyzer (Agilent Technologies) and a Qubit Fluorometer (Life Technologies). Libraries were pooled with other strains, re-quantified and run for 100 cycles in paired-end high output mode over multiple lanes on an Illumina HiSeq 2000 instrument using HiSeq Control Software v1.5.15.1 and Real-Time Analysis v1.13.48.0. CASAVA v1.8.2 was run to demultiplex reads and generate fastq files. Raw fastq reads were submitted to ENA as experiment ERX645969.

DNA-seq fastq sequences from ERX645969 were downloaded and mapped against a “holo-genome” consisting of the Release 5 version of the D. melanogaster genome (Ensembl Genomes Release 24, Drosophila_melanogaster.BDGP5.24.dna.toplevel.fa) and the Wolbachia wMel reference genome (Ensembl Genomes Release 24, Wolbachia_endosymbiont_of_drosophila_melanogaster.GCA_000008025.1.24) (Cunningham et al., 2015; Kersey et al., 2014). Holo-genome reference mapping was performed using bwa mem v0.7.5a (Li, 2013) with default parameters in paired-end mode. Mapped reads for all runs from the same sample were merged, sorted and converted to BAM format using samtools v0.1.19 (Li et al., 2009). BAM files were then used to create BCF and fastq consensus sequence files using samtools mpileup v0.1.19 (options -d 100000). Fastq consensus sequence files were converted to fasta using seqtk v1.0-r76-dirty (https://github.com/lh3/seqtk) and concatenated with consensus sequences of Wolbachia type strains from Chrostek et al. (2013). Maximum-likelihood phylogenetic analysis on resulting multiple alignments was performed using raxmlHPC-PTHREADS v8.1.16 (options -T 6 -f a -x 12345 -p 12345 -N 100 -m GTRGAMMA) (Stamatakis, 2014).

RNA-seq data analysis

We analysed total RNA-seq libraries from the modENCODE developmental time course, which samples 30 time points from the BDSC ISO1 substrain across the D. melanogaster life cycle including embryos, larvae, pupae, adult males, and adult females (Graveley et al., 2011; Brown et al., 2014; Duff et al., 2015). Total RNA-seq data from this project is 100 bp read length, paired-end and stranded, with two biological replicates available for 24 of the 30 time points. All non-adult samples are from mixed sex organisms in unknown ratios; adult female samples are from mated and virgin flies in unknown ratios.

Total RNA-seq fastq sequences from SRP001696 were downloaded and mapped against the holo-genome described above in paired-end mode using bwa mem v0.7.5a with default parameters. Accession numbers for individual samples are given in Supplemental File 1. Resulting mapped reads were sorted and converted to BAM format using samtools v0.1.19. Counts for both forward and reverse reads together were used to summarize numbers of reads mapping to the Wolbachia and D. melanogaster genomes. Forward reads from each read-pair (which are anti-sense orientation in the Illumina TruSeq Stranded Total RNA kit used) were converted to the opposite strand and combined with reverse reads to generate wiggle plots of strand-specific RNA-seq coverage.

Sorted BAM files were used to count reads overlapping protein-coding genes on the sense orientation by one or more base pair using BEDtools v2.22.0 (Quinlan and Hall, 2010) with the Ensembl Genomes Release 24 version of the Wolbachia genome annotation (Wolbachia_endosymbiont_of_drosophila_melanogaster.GCA_000008025.1.24.gtf). Since current gene models in Wolbachia correspond only to coding regions and not full-length transcripts, we chose a read counting strategy that allowed RNA-seq reads to extend beyond currently-annotated gene model limits. Only counts for the reverse read from each read-pair (the sense orientation in the Illumina TruSeq Stranded Total RNA kit used) were used for differential expression analysis and clustering.

We performed differential expression analysis using edgeR v3.6.8 (Robinson et al., 2010) using P-values adjusted with the Benjamini and Hochberg (1995) method to correct for multiple testing. Read counts were normalized using the trimmed mean of M-values method (Robinson and Oshlack, 2010) and models were fit using tagwise dispersion (Robinson and Smyth, 2007). To identify Wolbachia genes that change in any stage across the life cycle, we performed a single analysis using an ANOVA-like GLM approach (McCarthy et al., 2012) using all stages of the ISO1 developmental time course that had replicates (24 time points) with an adjusted p-value cutoff of 0.05. To identify Wolbachia genes that change between pairs of samples we used an exact test approach (Robinson and Smyth, 2008) with adjusted p-value 0.01 and two-fold change cutoffs.

Probabilistic clustering on all samples from the ISO1 time course (both with and without biological replicates) was performed with MBcluster.seq v.1.0 (Si et al., 2014) using the Poisson model with two clusters and the expectation maximization method. Because MBcluster.seq is a probabilistic method, we performed 1,000 runs of the clustering analysis. We matched cluster identifiers from different runs using the fact that the majority of genes are stably-expressed across the life-cycle, and defined the cluster with the majority of genes as “cluster 1” and the remaining genes as “cluster 2”. Genes was assigned to cluster 2 were further classified into sub-clusters 2a and 2b on the basis of the number of runs in which a gene was assigned to cluster 2.

Within-sample normalized read counts in units of transcripts per million (TPM) (Li and Dewey, 2011) were also used to generate between-sample correlation and gene-by-sample heatmaps. Effective gene length in TPM calculations was set to be $gene\_length+read\_length-1$ to account for reads that extend beyond annotated gene models. Differential expression and clustering analyses and visualization were performed in R v3.1.1 (Team, 2012).

Reverse Transcription Real-Time Quantitative PCR

RNA for reverse transcription real-time quantitative PCR (RT-qPCR) was obtained from embryos, adult males and adult virgin females for the BDSC ISO1 and w1118 strains. Two independent collections, each with five biological replicates per stage, were performed for each D. melanogaster line. For embryo collection, flies laid eggs for two hours on agar plates supplemented with 1:1 yeast/water paste. After 16 hours at 25$\mathrm{\SIUnitSymbolCelsius}$ the embryos were collected, treated with 2% sodium hypochlorite, and washed with sterile water before RNA extraction. 500 embryos were used per sample. For adult collection, males and females were separated immediately after eclosion and maintained on standard diet for 24 hours before RNA extraction. Ten adult flies were used per sample. Samples were homogenized with a plastic pestle in $1\text{\,}\mathrm{mL}$ of Trizol Reagent (Ambion, 15596-018). RNA was extracted according to manufacturer’s protocol and resuspended in $50\text{\,}\mathrm{\SIUnitSymbolMicro L}$ of DEPC-treated water (Ambion, AM9915G). RNA concentrations were determined using NanoDrop ND-1000 Spectrophotometer. cDNA was prepared from $4\text{\,}\mathrm{\SIUnitSymbolMicro g}$ of total RNA using random primers (Promega, C1181) and M-MLV reverse transcriptase (Promega, M1705). Primers were allowed to bind to the template RNA at 70$\mathrm{\SIUnitSymbolCelsius}$ for 5 minutes and the reaction proceeded at 25$\mathrm{\SIUnitSymbolCelsius}$ for 10 minutes, 37$\mathrm{\SIUnitSymbolCelsius}$ for 60 minutes, and 85$\mathrm{\SIUnitSymbolCelsius}$ for 10 minutes.

RT-qPCR reactions were carried out in CFX384 Real-Time PCR Detection System (BioRad). Reactions were carried in 384-well plates (BioRad, HSP3805) using iTaq Universal SYBR Green Supermix (Bio Rad, 172-5125), $0.15\text{\,}\mathrm{\SIUnitSymbolMicro M}$ of each primer and $5\text{\,}\mathrm{\SIUnitSymbolMicro l}$ of cDNA diluted 1:50 in water. Each complete, independent collection of each D. melanogaster line was analysed in one plate. Each plate contained two technical replicates of every sample for each set of primers. Sequences of the primers used for RT-qPCR can be found in Supplemental File 4. Amplification conditions were set up as follows: 50$\mathrm{\SIUnitSymbolCelsius}$ for 2 minutes, 95$\mathrm{\SIUnitSymbolCelsius}$ for 10 minutes, followed by 40 cycles of 95$\mathrm{\SIUnitSymbolCelsius}$ for 30 seconds, 57$\mathrm{\SIUnitSymbolCelsius}$ for 1 minute and 72$\mathrm{\SIUnitSymbolCelsius}$ for 30 seconds. Melting curves were analyzed to confirm specificity of amplified products and Ct values were obtained using Bio-Rad CFX Manager default threshold settings. Relative transcript expression levels were calculated by the method of Pfaffl (2001). Gene expression was normalized using as reference genes the three stably-expressed Wolbachia genes WD1043, WD1063, and WD1071, which were selected because they exhibit low fold-change and low coefficient of variation across the ISO1 life-cycle time course (de Jonge et al., 2007). Expression values were calculated relative to embryonic expression levels.

Relative gene expression values were analyzed in R v3.1.1 (Team, 2012) by fitting a linear mixed-effect model to the data of each gene using the lmer package (v2.0-20), comparing the effect of stage (embryo, adult male, and adult female) with a Tukey’s all-pair comparison using the glht package (v1.3-9). The data of the two genotypes were analysed separately and together. For the linear mixed-model, the stage and genotype (in the joint analysis) were considered fixed effects, while independent collection was considered a random effect. No correction was applied to p-values to account for multiple testing, and thus $alpha$-levels for significance were set at 0.001 based on Bonferroni correction.

Functional and comparative annotation of Wolbachia genes

We generated functional annotations for Wolbachia genes using three sources: (i) by querying wMel open reading frames against the Genbank nucleotide (nt) database (April 2012, 15,938,872 sequences; 40,783,330,152 letters) using TBLASTN v2.2.25+ (Altschul et al., 1997); (ii) by querying wMel open reading frames against the Pfam-A.hmm database (v26.0) (Finn et al., 2014) using hmmscan v3.0 with default options (http://hmmer.org); and (iii) by using the original functional annotations generated by TIGR. CodonW v1.4.4 was used to generate estimates of and GC bias and codon bias in terms of effective number of codons ($N_{c}$) (http://codonw.sourceforge.net).

We identified homologs of wMel genes by conducting an all-vs-all search of genes from the following complete Wolbachia genomes using BLASTP 2.2.27+ with default options: wRi (supergroup A strain from D. simulans, NC_012416), wPip-Pel (supergroup B strain from Culex quinquefasciatus, NC_010981), and wBm (supergroup D strain from Brugia malayi, NC_006833). The best hit to a gene in genome A was defined as the gene in genome B that had the highest bit score. Homology groups were defined such that all members of a group had to have reciprocal best hits with all other members of the group (complete linkage), which permits paralogs to be included in a group. Clustering is dependent on the order in which best hits are considered, and thus all best hits were sorted by highest bit score before clustering so that the strongest hits were considered first.

List of Abbreviations Used

ISO1, isogenic strain 1; ANK, ankyrin repeat domain; modENCODE, model organism encyclopedia of DNA elements; wMel, Wolbachia from D. melanogaster; wMelPop, Popcorn strain of Wolbachia from D. melanogaster; wMelCS, Wolbachia from Canton S strain of D. melanogaster; RNA-seq, RNA sequencing; BDSC, Bloomington Drosophila Stock Center; BDGP, Berkeley Drosophila Genome Project; L1, first larval instar; L2, second larval instar; L3, third larval instar; TPM, transcripts per million; ANOVA, analysis of variance; GLM, generalized linear model; RT-qPCR, reverse-transcriptase real-time quantitative PCR; ncRNA, non-coding RNA.

Competing Interests

The authors declare that they have no competing interests.

Authors’ Contributions

FG carried the RNA-seq analyses, participated in the design of the study, and helped draft the manuscript. CRC performed RT-qPCR experiments. DEM carried out the Wolbachia infection status and genome sequencing experiments. DWR and ILN generated functional and comparative annotations. RSH participated in the coordination of the study. LT participated in the design and coordination of the study, carried out RT-qPCR analyses, and helped draft the manuscript. CMB conceived of the study, participated in its design and coordination, performed phylogenomic analyses, contributed to the RNA-seq analyses, and drafted the manuscript. All authors read and approved the final manuscript.

Description of Supporting Data Files

The following additional data are available with the online version of this paper. Additional data file 1 is a table summarizing the numbers of mapped reads and expressed genes for each RNA-seq sample. Additional data file 2 is a table summarizing reads counts, expression levels, results of differential expression an functional/comparative annotations of Wolbachia genes. Additional data file 3 is a table summarizing the results of RT-qPCR analyses. Additional data file 4 is a table of PCR primers used for the RT-qPCR analyses.

Figures

Figure 1: Phylogeny and expression of Wolbachia in D. melanogaster. A. Phylogenetic tree of Wolbachia strains based on whole genome sequences from this study (ISO1, red), Wu et al. (2004) (wMel_ref), Chrostek et al. (2013) (all others). The scale bar for branch lengths is units of substitutions per site. The Wolbachia variant in ISO1 is very closely related to the wMel reference genome and to the wMel variant in Chrostek et al. (2013). B. Gene models and RNA-seq coverage plots for a 12-gene window of the Wolbachia genome showing gene expression levels in representative stages of the D. melanogaster modENCODE RNA-seq life-cycle time course. Gene models (pointed rectangles) and RNA-seq coverage (strand-specific wiggle plots of number of reads mapped to each base pair) are shown on the forward and reverse strands in blue and red, respectively. RNA-seq plots are shown on the same absolute y-axis scale. To provide an internal normalization factor for comparison across samples, mean coverage of the stably-expressed Wsp/WD1063 gene (not shown in this interval) divided by twenty is depicted by the dashed line in each panel. A unannotated non-coding RNA transcript is express anti-sense to the 3’ end of WD0974. This example shows a set of three consecutive genes (WD0973, WD0974 and WD0975) that are specifically up-regulated in males in comparison to neighboring genes and co-transcribed as a single operon.

Figure 2: Wolbachia gene expression levels are highly-correlated across the D. melanogaster life cycle. Each cell in the heatmap represents a Pearson correlation coefficient for a pair of samples in the ISO1 total RNA-seq dataset computed using expression levels in units of TPM for all genes. Higher similarity among pairs of samples is represented by bright yellow and lower similarity by dark blue, with all samples showing correlation coefficients of $>$0.94. All but six stages in the modENCODE total RNA-seq time course have biological replicates (Embryos 4-6 hrs, Embryos 6-8 hrs, Embryos 8-10 hrs, Embryos 14-16 hrs, Embryos 16-18 hrs, and Embryos 20-22 hrs). Replicate samples from the same stage were collected in two independent series, denoted by _r1 and _r2 suffixes. Correlation among biological replicates of the same stage is very high, with the exception of late larval L3 stages (dark blue gut, light blue gut and clear gut) where samples from different stages of the same replicate series had higher correlation than replicate samples from the same stage, leading to the observed checkerboard pattern.

Figure 3: Wolbachia genes show differential expression across the D. melanogaster life-cycle. Row-normalized expression levels are visualized as a heatmap where each row represents a gene (ordered top-to-bottom by its position in the genome) and each cell represents the relative expression level for a particular sample in terms of Z-scores (observed TPM minus row mean TPM, divided by the standard deviation of TPMs for that row). Values higher than row means are represented by yellow, and values lower than row means are represented by red. Gene names and identifiers are shown on the left. Membership in dynamically-expressed gene classes is shown by dots on the right. Class 1 includes genes that show down-regulation after embryogenesis. Class 2 includes genes that show up-regulation after embryogenesis, with peaks of expression in larval and pupal stages. Class 3 includes genes that show up-regulation after embryogenesis, with peaks of expression in adult. Classification of gene sets is not mutually exclusive. Stages that lack biological replicates in the modENCODE total RNA-seq time course were not used in this analysis and are not shown here. A version of this figure with non-row-normalized expression levels can be found in Supplemental Figure 2.

Figure 4: Confirmation of stably- and differentially-expressed genes by RT-qPCR. A. Relative expression based on RNA-seq in ISO1. B. Relative expression based on RT-qPCR for ISO1. C. Relative expression based on RT-qPCR for w1118. Stages correspond to embryo 16-18 hrs (E), 1-day post-eclosion females (F), and 1-day post-eclosion males (M). RNA-seq expression levels for each gene were based on TPMs and normalized relative to embryonic expression levels for that gene. RT-qPCR expression levels for each gene were normalized using the mean expression of three stably-expressed reference genes (WD1043, WD1063, WD1071) and are calculated relative to embryonic expression levels. Relative expression levels are shown as boxplots with boxes representing the interquartile range (IQR), black lines representing median values, and dots representing samples that lie outside 1.5 x IQR. In A, there is one biological replicate for the embryonic stage and two replicates per stage for males and females. In B and C, for each stage in each genotype, there are ten biological replicates from two independent collections (five replicates from each collection). Genes predicted to be stably-expressed, up-regulated (WspB/WD0009, WD0061, WD0830, WD0837, WD1289) or down-regulated (groES/WD0308, Hsp90/WD1277) between embryos and adults by RNA-seq showed expected patterns by RT-qPCR. Results of GLMs for differences in RT-qPCR expression levels between stages can be found in Supplemental File 3.

Figure 5: Wolbachia genes show age-dependent sex-biased expression. Row-normalized expression levels are visualized as a heatmap where each row represents a gene (ordered top-to-bottom by its position in the genome), and each cell represents the relative expression level for a particular sample in terms of Z-scores (observed TPM minus row mean TPM, divided by the standard deviation of TPMs for that row). Values higher than row means are represented by yellow, and values lower than row means are represented by red. Gene names and identifiers are shown on the left. Dots on the right indicate if a gene is differentially expressed between males and females at 1 day, 5 days or 30 days post-eclosion, respectively. All 41 genes identified as differentially expressed in pairwise comparisons between males and females at any age in ISO1 are shown here.

Figure 6: Expression profiles of Wolbachia genes previously implicated in host-microbe interactions. A. ANK-containing and type IV secretion system genes. B. Octomom genes. C. Prophage WO-A genes. D. Prophage WO-B genes. The 23 ANK-containing genes in panel A are distributed throughout the Wolbachia genome. The nine Type IV secretion system genes are found in three different genomic intervals. The Octomom, prophage WO-A and prophage WO-B regions are each from single intervals in the Wolbachia genome. The Octomom region only contains seven genes, since WD0510 is not included in the Ensembl annotation for Wolbachia wMel. Phage coordinates are from Metcalf et al. (2014). Expression levels are visualized as a heatmap where each row represents a gene (ordered top-to-bottom by its position in the genome) and each cell represents expression in units of TPM. A pseudocount of one was added to each gene’s TPM before transforming to log2 scale. Values with higher levels of expression are represented by yellow, and values with lower levels of expression are represented by red. All panels are on the same heatmap color scale. Gene names and identifiers are shown on the left. All stages including those that lack biological replicates in the modENCODE time course are shown here.

Supplemental Figures

Supplemental Figure 1: Correlation between codon usage bias and expression level of Wolbachia genes across different stages of the D. melanogaster life cycle. Pairwise scatterplots between Wolbachia gene expression levels (in units of TPM) and codon usage bias (measured as effective number of codons, $N_{c}$), with associated Pearson correlation coefficients. Each panel represents correlation of codon usage with a different sample in the modENCODE total RNA life cycle time course. A pseudocount of one was added to each gene’s TPM before transforming to log2 scale.

Supplemental Figure 2: Non-row-normalized expression levels for Wolbachia genes that differ in expression across the D. melanogaster life cycle. Expression levels are visualized as a heatmap where each row represents a gene (ordered top-to-bottom by its position in the genome) and each cell represents expression in units of TPM. A pseudocount of one was added to each gene’s TPM before transforming to log2 scale. Values with higher levels of expression are represented by yellow, and values with lower levels of expression are represented by red. Gene names and identifiers are shown on the left. Membership in different dynamically-expressed gene classes is shown by dots on the right. Class 1 includes genes that show down-regulation after embryogenesis. Class 2 includes genes that show up-regulation after embryogenesis, with peaks of expression in larval and pupal stages. Class 3 includes genes that show up-regulation after embryogenesis, with peaks of expression in adult. Classification of gene sets is not mutually exclusive. Stages that lack biological replicates in the modENCODE total RNA-seq time course were not used in this analysis and are not shown here.

Supplemental Figure 3: Clustering analysis of Wolbachia gene expression in the modENCODE life cycle time course. A. Histogram showing number of independent clustering runs (out of 1000) a gene was affiliated with the variable gene cluster 2. Three distinct peaks were observed, one for stably-expressed genes (cluster 1, n=1033), and two peaks for variable genes that we denote cluster 2a (n=103) and cluster 2b (n=59). B. Normalized expression profiles for genes in Cluster 1. C. Normalized expression profiles for genes in Cluster 2a. D. Heat map of row-normalized expression levels for genes in Cluster 2a. E. Normalized expression profiles for genes in Cluster 2b. F. Heat map of row-normalized expression levels for genes in Cluster 2b. For panels B, C and E, TPMs for each gene at each stage are normalized by subtracting the mean TPM for that gene across different life cycle stages (shown in grey). The mean and median of normalized expression levels for all genes at each stage are show for each cluster in black and blue, respectively. For panels D and F, row-normalized expression levels are visualized as a heatmap where each row represents a gene (ordered top-to-bottom by its position in the genome), and each cell represents the relative expression level for a particular sample in terms of Z-scores (observed TPM minus row mean TPM, divided by the standard deviation of TPMs for that row). Values higher than row means are represented by yellow, and values lower than row means are represented by red. The heatmap color scale differs in panels D and F.

Supplemental Figure 4: Wolbachia genes with sex-biased expression are often found in operons. Wiggle plots of Wolbachia expression levels for seven clusters of Wolbachia genes with sex-biased expression. Gene models and RNA-seq coverage for each stage are shown for the forward and reverse strands in blue and red, respectively. Gene models and RNA-seq coverage for each stage are shown for the forward and reverse strands in blue and red, respectively. RNA-seq plots are shown on the same absolute y-axis scale. To provide an internal normalization factor for comparison across samples, mean coverage of the stably-expressed Wsp/WD1063 gene (not shown in this interval) divided by twenty is depicted by the dashed line in each panel. Six out of seven clusters (WD0061–WD0062, WD0291–WD0292, WD0837–WD0838, WD0973–WD0975, WD1269–WD1270 and WD1288–WD1290) were confirmed as operons based on contiguous mapping of RNA-seq reads. The third cluster depicted contains two divergently transcribed genes (WD0763–WD0764) that are not co-transcribed as an operon.

Supplemental Figure 5: Expression profiles of all Wolbachia genes across the D. melanogaster life cycle. The two major prophage regions – WO-A and WO-B – in the wMel genome are indicated. Expression levels are visualized as a heatmap where each row represents a gene (ordered top-to-bottom by its position in the genome) and each cell represents expression in units of TPM. A pseudocount of one was added to each gene’s TPM before transforming to log2 scale. Values with higher levels of expression are represented by yellow, and values with lower levels of expression are represented by red. Gene names and identifiers are shown on the left. All stages including those that lack biological replicates in the modENCODE time course are shown here.

Supplemental Figure 6: Putative anti-sense noncoding RNAs in the Wolbachia WO-A and WO-B regions. Wiggle plots of Wolbachia expression levels for two highly expressed putative anti-sense noncoding RNA genes that overlap the 3’ ends of the major phage capsid genes of both WO-A (WD0274) and WO-B (WD0604). Gene models and RNA-seq coverage for each stage are shown for the forward and reverse strands in blue and red, respectively. RNA-seq plots are shown on the same absolute y-axis scale. To provide provide an internal normalization factor for comparison across samples, mean coverage of the stably-expressed Wsp/WD1063 gene (not shown in this interval) divided by twenty is depicted by the dashed line in each panel. These transcribed regions are the most highly expressed sequences in both of the WO-A and WO-B regions, and are found in conserved locations of paralogs with divergent sequences.

Supplemental Files

1. A .tsv file with SRA IDs, summary of mapped reads for D. melanogaster and Wolbachia, number of expressed genes (defined as genes with non-zero TPM or genes with $\geq 2$ mapped reads per gene), mean TPM for the sample (same for all samples, inverse of gene number time one million), standard deviation of TPM for the sample.

2. A .tsv file with gene IDs, coordinates, number of reads (from read 2 of paired end data) mapping to the sense strand in each sample (_r1 = replicate 1, _r2 = replicate 2), estimated TPM for each sample, number of runs found in cluster 2, cluster assignment, adjusted p-value in life-cycle GLM, log2 fold-change in life-cycle GLM vs embryo 0-2 hours, maximum fold change between any two stages in life-cycle GLM, adjusted p-values and log2 fold change for pairwise exact tests between male and female samples at 1, 5 and 30 days, gene name, annotated gene product, effective number of codons, GC content, number of homologs in wMel, wRi, wPip-Pel, and wBm genomes.

3. A .tsv file with results of GLM for RT-qPCR analysis in ISO1 and w1118. P-values reported are not adjusted for multiple testing, and thus $\alpha$-levels for significance were set at 0.001.

4. A .tsv file with PCR primers for RT-qPCR experiments.