A systematic study of electron or hole transfer along DNA dimers, trimers and polymers

Abstract

A systematic study of electron or hole transfer along DNA dimers, trimers and polymers is presented with a tight-binding approach at the base-pair level, using the relevant on-site energies of the base-pairs and the hopping parameters between successive base-pairs. A system of $N$ coupled differential equations is solved numerically with the eigenvalue method, allowing the temporal and spatial evolution of electrons or holes along a $N$ base-pair DNA segment to be determined. Useful physical quantities are defined and calculated including the maximum transfer percentage $p$ and the pure maximum transfer rate $\frac{p}{T}$ for cases where a period $T$ can be defined, as well as the pure mean carrier transfer rate $k$ and the speed of charge transfer $u=kd$, where $d=N\times$ 3.4 Å is the charge transfer distance. The inverse decay length $\beta$ used for the exponential fit $k=k_{0}\textrm{exp}(-\beta d)$ and the exponent $\eta$ used for the power law fit $k=k_{0}^{\prime}N^{-\eta}$ are computed. The electron and hole transfer along polymers including poly(dG)-poly(dC), poly(dA)-poly(dT), GCGCGC…, ATATAT… is studied, too. $\beta$ falls in the range $\approx$ 0.2 - 2 Å^-1, $k_{0}$ is usually 10^-2-10^-1 PHz although, generally, it falls in the wider range 10^-4-10 PHz. $\eta$ falls in the range $\approx$ 1.7 - 17, $k_{0}^{\prime}$ is usually $\approx 10^{-2}$-10^-1 PHz, although generally, it falls in the wider range $\approx 10^{-4}$-10³ PHz. Finally, the results are compared with the predictions of Wang et al. Phys. Rev. Lett. 93, (2004) 016401, as well as experiments, including Murphy et al. Science 262, 1025 (1993); Arkin et al. Science 273, 475 (1996); Giese et al. Angew. Chem. Int. Ed. 38, 996 (1999); Giese et al. Nature 412, 318 (2001). This method allows to assess the extent at which a specific DNA segment can serve as an efficient medium for charge transfer.

I Introduction

It is not the purpose of this work to discuss the reasons charge transfer along deoxyribonucleic acid (DNA) is crucial for molecular biology, genetics, and nanotechnology. The interested reader may consult valuable reviews e.g. Refs. GenereuxBarton:2010 ; Giese:2002 ; Endres:2004 . The aim is to present a convenient way to quantify electron or hole transport along specific DNA segments using a simple tight-binding approach which can easily be implemented by interested colleagues.

In this spirit, much interest has been devoted recently to the study of the tight-binding parameters which are relevant to charge transport along DNA Endres:2004 ; HKS:2010-2011 ; Senthilkumar:2005 ; YanZhang:2002 ; SugiyamaSaito:1996 ; HutterClark:1996 ; ZhangLiEtAl:2002 ; LiCaiSevilla:2001 ; LiCaiSevilla:2002 ; ShuklaLeszczynski:2002 ; Varsano:2006 ; Voityuk:2001 ; Migliore:2009 ; Kubar:2008 ; Ivanova:2008 . Among these works, parameters either for electrons or holes were calculated HKS:2010-2011 , employing a novel parametrization within a simplified linear combination of atomic orbitals (LCAO) method HKS:2009 . Specifically, the $\pi$ molecular structure of the four DNA bases [adenine (A), thymine (T), guanine (G), cytosine (C)] was investigated, the HOMO (highest occupied molecular orbital) and the LUMO (lowest unoccupied molecular orbital) wave functions and energies calculated, and then used to obtain the wave functions of the two B-DNA base-pairs (A-T and G-C) using a linear combination of molecular orbitals (LCMO) of the complementary bases (A and T for A-T, G and C for G-C). Then the complete set of the charge transfer parameters (between successive base-pairs and also between neighboring bases considering all possible combinations) both for electrons and holes was estimated. Conclusively, to date all these parameters either for electrons (traveling through LUMOs) or for holes (traveling through HOMOs) are available in the literature. In the present article we are going to use them to study the temporal and spatial evolution of an electron or a hole as it is transferred along DNA.

The transfer of electrons or holes along DNA can be described at either (I) the base-pair level or (II) the single base level HKS:2010-2011 . One has to know the relevant on-site energies of either (I) the base-pairs or (II) the single bases. In addition, one has to provide, the hopping parameters between either (I) successive base-pairs or (II) neighboring bases taking all possible combinations into account [(IIa) successive bases in the same strand, (IIb) complementary bases within a base-pair, (IIc) diagonally located bases of successive base-pairs in opposite strands]. Knowing these parameters, to calculate the temporal and spatial evolution of carriers along a $N$ base-pair segment of DNA one has to solve a system of either (I) $N$ or (II) $2N$ coupled differential equations. In the present work we use the simplest approach (I) which is analyzed in Section II. Next, in Section III we solve numerically the relevant system of coupled differential equations and examine charge transfer in DNA dimers, trimers and polymers. We also compare our results with available experiments. Finally, in Section IV we state our conclusions.

II Charge transfer in B-DNA. Description at the base-pair level

We assume that extra electrons inserted in DNA travel through LUMOs, while inserted holes travel through HOMOs. We symbolize successive base-pairs of double-stranded DNA by $\ldots,\mu-1,\mu,\mu+1,\ldots$ and the description can be done either for HOMOs or for LUMOs HKS:2010-2011 . For a description at a base-pair level we need the HOMO or the LUMO on-site energies of the base-pairs and the corresponding hopping parameters between successive base-pairs. The relevant parameters are given in Table 1 and Table 2.

Table 1: The on-site energies $E^{bp}_{H/L}$ for the two possible base-pairs A-T and G-C, calculated by various authors. ${E^{bp\;\textrm{used}}_{H/L}}$ are the values actually used for the solution of Eq. 4 in this article. The first $\pi$-$\pi^{*}$ transition energies $E_{\pi-\pi^{*}}$ for the two B-DNA base-pairs are also shown. Except for Ref. HKS:2010-2011 these are ab initio calculations which tend to overestimate the first $\pi$-$\pi^{*}$ transition energy. All energies are given in eV.

B-DNA base-pair A-T G-C reference $E_{H}^{bp}$ $-$8.3 $-$8.0 HKS:2010-2011 $E_{L}^{bp}$ $-$4.9 $-$4.5 HKS:2010-2011 $E_{\pi-\pi^{*}}$ 3.4 3.5 HKS:2010-2011 $E_{H}^{bp\;\mathrm{first\;pr.}}$ $-$(7.8-8.2) $-$(6.3-7.7) SugiyamaSaito:1996 ; HutterClark:1996 ; ZhangLiEtAl:2002 ; LiCaiSevilla:2001 ; LiCaiSevilla:2002 ; ShuklaLeszczynski:2002 $E_{\pi-\pi^{*}}^{\mathrm{first\;pr.}}$ 6.4 4.3-6.3 ShuklaLeszczynski:2002 ; Varsano:2006 ${E^{bp\;\textrm{used}}_{H}}$ 8.3 8.0 HKS:2010-2011 ${E^{bp\;\textrm{used}}_{L}}$ $-$4.9 $-$4.5 HKS:2010-2011

Table 2: The hopping parameters between successive base-pairs for all possible combinations. $t_{H}^{bp}$ ($t_{L}^{bp}$) refers to hole (electron) hopping through HOMOs (LUMOs). The notation is given in the text. The values listed in Table 3 of Ref. HKS:2010-2011 , in Table II or Ref. Voityuk:2001 , in Table 5 (“Best Estimates”) of Ref. Migliore:2009 , in Table 4 of Ref. Kubar:2008 (two estimations given), in Table 2 of Ref. Ivanova:2008 , and the values extracted approximately from Fig. 4 of Ref. Endres:2004 are shown. These quantities represent the parameters $t^{bp(\mu;\mu\pm 1)}_{H/L}$ which appear in Eq. (4). Finally, ${t^{bp\;\textrm{used}}_{H/L}}$ are the parameters actually used in this work for the solution of Eq. 4. All hopping integrals $t_{H/L}^{bp}$ are given in meV.

Base-pair $t_{H}^{bp}$ $|t_{H}^{bp}|$ $t_{H}^{bp}$ $t_{H}^{bp}$ $t_{H}^{bp}$ $t_{H}^{bp}$ $t_{H}^{bp\;\textrm{used}}$ $t_{L}^{bp}$ $t_{L}^{bp}$ $t_{L}^{bp\;\textrm{used}}$ sequence HKS:2010-2011 Voityuk:2001 Endres:2004 Migliore:2009 Kubar:2008 Ivanova:2008 HKS:2010-2011 Endres:2004 AA, TT $-$8 26 $-$25 8-17 19(19) 22 20 $-$29 35 $-$29 AT 20 55 47(74) 37 $-$35 0.5 0.5 AG, CT $-$5 25 $-$50 35(51) 43 30 3 35 3 AC, GT 2 26 25(38) 20 $-$10 32 32 TA 47 50 32(68) 52 $-$50 2 2 TG, CA $-$4 27 11(11) 25 10 17 17 TC, GA $-$79 122 $-$160 71(108) 60 110 $-$1 35 $-$1 GG, CC $-$62 93 $-$140 75 72(101) 63 100 20 35 20 GC 1 22 20(32) 22 $-$10 $-$10 $-$10 CG $-$44 78 51(84) 74 50 $-$8 $-$8

We use the notation YX to denote two successive base-pairs, according to the following convention for the DNA strands orientation

$$\vdots$$

$$5^{\prime} 3^{\prime}$$

Y $$- \textrm{Y}_{\textrm{compl}}$$

X $$- \textrm{X}_{\textrm{compl}}$$

$$3^{\prime} 5^{\prime}$$ (1)

$$\vdots$$

X, X${}_{\textrm{compl}}$, Y, Y${}_{\textrm{compl}}$ denote DNA bases. X${}_{\textrm{compl}}$ (Y${}_{\textrm{compl}}$) is the complementary base of X (Y). In other words, the notation YX means that the bases Y and X of two successive base-pairs are located at the same strand in the direction $5^{\prime}-3^{\prime}$. X-X${}_{\textrm{compl}}$ is the one base-pair and Y-Y${}_{\textrm{compl}}$ is the other base-pair, separated and twisted by 3.4 Å and $36^{\circ}$, respectively, relatively to the first base-pair. For example, the notation AC denotes that the base-pair dimer consists of an adenine-thymine and a cytosine-guanine base-pair, where one strand contains A and C in the direction $5^{\prime}-3^{\prime}$ and the complementary strand contains T and G in the direction $3^{\prime}-5^{\prime}$.

For a description at the base-pair level, the time-dependent single carrier (hole/electron) wave function of the DNA segment of interest, $\Psi^{DNA}_{H/L}({\bf r},t)$, is considered as a linear combination of base-pair wave functions with time-dependent coefficients, i.e.,

$$\Psi^{DNA}_{H/L}({\bf r},t)=\sum_{\mu=1}^{N}A_{\mu}(t)\;\Psi^{bp(\mu)}_{H/L}({\bf r}),$$ (2)

where $\Psi^{bp(\mu)}_{H/L}({\bf r})$ is the $\mu^{th}$ base-pair’s HOMO or LUMO wave function ($H/L$) and the sum is extended over all base-pairs of the DNA segment under consideration. Hence, $|A_{\mu}(t)|^{2}$ gives the probability of finding the carrier at the base-pair $\mu$ at the time $t$.

Starting from the time-dependent Schrödinger equation,

$$i\hbar\frac{\partial\Psi^{DNA}_{H/L}({\bf r},t)}{\partial t}=H^{DNA}\Psi^{DNA}_{H/L}({\bf r},t),$$ (3)

using Eq. 2, and following the procedure and the assumptions described in detail by Hawke et al. HKS:2010-2011 , one obtains that the time evolution of the coefficients $A_{\mu}(t)$ obeys the tight-binding system of differential equations

$$i\hbar\frac{dA_{\mu}}{dt}=E^{bp(\mu)}_{H/L}A_{\mu}+t^{bp(\mu;\mu-1)}_{H/L}A_{\mu-1}+t^{bp(\mu;\mu+1)}_{H/L}A_{\mu+1}.$$ (4)

$E^{bp(\mu)}_{H/L}$ is the HOMO/LUMO on-site energy of base-pair $\mu$, and $t^{bp(\mu;\mu^{\prime})}_{H/L}$ is the hopping parameter between base-pair $\mu$ and base-pair $\mu^{\prime}$.

Hence, one can use $E^{bp(\mu)}_{H/L}$ (cf. Table 1) and $t^{bp(\mu;\mu^{\prime})}_{H/L}$ (c.f. Table 2) computed already by many authors in order to numerically solve the system of equations (4) and obtain, through $A_{\mu}(t)$, the time evolution of a carrier propagating along the DNA segment of interest. Regarding the tight-binding description of hole transport, the corresponding tight-binding parameters should be taken with the opposite sign of the calculated on-site energies and transfer hopping integrals Senthilkumar:2005 . This means that for describing hole transport at the base-pair level, the on-site energies $E_{H}^{bp}$ presented in the second row of Table 1 and the hopping transfer integrals $t_{H}^{bp}$ presented in the second column of Table 2 should be used with opposite signs to provide the tight-binding parameters of Eq. 4.

The on-site energies $E^{bp}_{H/L}$ for the two possible base-pairs A-T and G-C, calculated by various authors, are listed in Table 1. ${E^{bp\;\textrm{used}}_{H/L}}$ are the values actually used for the solution of Eq. 4 in this article. The hopping parameters $t_{H/L}^{bp}$ for all possible combinations of successive base-pairs, calculated by various authors, are given in Table 2. ${t^{bp\;\textrm{used}}_{H/L}}$ are the values actually used for the solution of Eq. 4 in this article. Due to the symmetry between base-pair dimers YX and X${}_{\textrm{compl}}$Y${}_{\textrm{compl}}$, the number of different hopping parameters is reduced from sixteen to ten. In Table 2 base-pair dimers exhibiting the same transfer parameters are listed together in the first column. We include in Table 2 the values listed: in Table 3 of Ref. HKS:2010-2011 , in Table II or Ref. Voityuk:2001 , in Table 5 (“Best Estimates”) of Ref. Migliore:2009 , in Table 4 of Ref. Kubar:2008 (two estimations given), in Table 2 of Ref. Ivanova:2008 , and the values extracted approximately from Fig. 4 of Ref. Endres:2004 . In Refs. Kubar:2008 ; Migliore:2009 ; Ivanova:2008 all values given are positive, in Ref. Voityuk:2001 the authors explicitly state that they quote absolute values, while in Refs. HKS:2010-2011 ; Endres:2004 the sign is included. In Ref. HKS:2010-2011 all $t_{H}^{bp}$ and $t_{L}^{bp}$ have been calculated, while in Ref. Endres:2004 only the values of $t_{H}^{bp}$ for a few cases are approximately given. According to Ref. BlancafortVoityuk:2006 the approximation used in Ref. Voityuk:2001 in general overestimates the transfer integrals. Summarizing, taking all the above into account, we use the values ${E^{bp\;\textrm{used}}_{H/L}}$ and ${t^{bp\;\textrm{used}}_{H/L}}$.

To solve Eq.  4 we define the vector matrix

$$\vec{x}(t)=\left[\begin{array}[]{c}A_{1}(t)\\ A_{2}(t)\\ \vdots\\ A_{N}(t)\end{array}\right]$$ (5)

and therefore Eq.  4 reads

$$\dot{\vec{x}}(t)=\widetilde{\mathcal{A}}\vec{x}(t),$$ (6)

$$\widetilde{\mathcal{A}}=-\frac{i}{\hbar}\textrm{A},$$ (7)

$$\textrm{A}=\left[\begin{array}[]{ccccccc}E^{bp(1)}_{H/L}&t^{bp(1;2)}_{H/L}&0&\cdots&0&0&0\\ t^{bp(2;1)}_{H/L}&E^{bp(2)}_{H/L}&t^{bp(2;3)}_{H/L}&\cdots&0&0&0\\ \vdots&\vdots&\vdots&\vdots&\vdots&\vdots&\vdots\\ 0&0&0&\cdots&t^{bp(N-1;N-2)}_{H/L}&E^{bp(N-1)}_{H/L}&t^{bp(N-1;N)}_{H/L}\\ 0&0&0&\cdots&0&t^{bp(N;N-1)}_{H/L}&E^{bp(N)}_{H/L}\end{array}\right].$$ (8)

The matrix A is a symmetric tridiagonal matrix. We solve Eq. 6 using the eigenvalue method, i.e. we look for solutions of the form $\vec{x}(t)=\vec{v}e^{\tilde{\lambda}t}\Rightarrow\dot{\vec{x}}(t)=\tilde{\lambda}\vec{v}e^{\tilde{\lambda}t}$. Hence, Eq. 6 reads

$$\widetilde{\mathcal{A}}\vec{v}=\tilde{\lambda}\vec{v},$$ (9)

or

$$\textrm{A}\vec{v}=\lambda\vec{v},$$ (10)

with $\tilde{\lambda}=-\frac{i}{\hbar}\lambda$. In other words, we solve numerically an eigenvalue problem. We also compare our numerical results with known analytical solutions in some simple known cases.

For example, in the cases of poly(dA)-poly(dT) or poly(dG)-poly(dC) DNA segments the matrix A becomes a symmetric tridiagonal uniform matrix

$$\textrm{A}=\left[\begin{array}[]{ccccccc}E^{bp}&t^{bp}&0&\cdots&0&0&0\\ t^{bp}&E^{bp}&t^{bp}&\cdots&0&0&0\\ \vdots&\vdots&\vdots&\vdots&\vdots&\vdots&\vdots\\ 0&0&0&\cdots&t^{bp}&E^{bp}&t^{bp}\\ 0&0&0&\cdots&0&t^{bp}&E^{bp}\end{array}\right]$$ (11)

whose eigenvalues are $\lambda_{k}=E^{bp}+2t^{bp}\textrm{cos}(\frac{k\pi}{N+1})$, where $k=1,2,\dots,N$. Hence, all eigenvalues are real and distinct being the matrix symmetric ($\textrm{A}=\textrm{A}^{\textrm{T}}$), all eigenvalues are symmetric around $E^{bp}$, for odd $N$ the trivial eigenvalue ($=E^{bp}$) exists, and all eigenvalues lie in the interval $(E^{bp}-2t^{bp},E^{bp}+2t^{bp})$. The corresponding eigenvectors i.e. the $k^{\prime}$ component of the $k$ eigenvector are $u_{k^{\prime}k}\propto\textrm{sin}(k^{\prime}k\frac{\pi}{N+1})$, where $k=1,2,\dots,N$ and $k^{\prime}=1,2,\dots,N$. One needs to make the substitution $k\to N+1-k$ to obtain the ascending order.

For long enough segments of DNA one could envision the cyclic case with $\textrm{A}(1,N)=t^{bp(1;N)}_{H/L}=\textrm{A}(N,1)=t^{bp(N;1)}_{H/L}\neq 0$. Hence, in the cases of cyclic poly(dA)-poly(dT) or poly(dG)-poly(dC) DNA segments the matrix A becomes a symmetric tridiagonal uniform matrix with two “perturbed corners” i.e.

$$\textrm{A}=\left[\begin{array}[]{ccccccc}E^{bp}&t^{bp}&0&\cdots&0&0&t^{bp}\\ t^{bp}&E^{bp}&t^{bp}&\cdots&0&0&0\\ \vdots&\vdots&\vdots&\vdots&\vdots&\vdots&\vdots\\ 0&0&0&\cdots&t^{bp}&E^{bp}&t^{bp}\\ t^{bp}&0&0&\cdots&0&t^{bp}&E^{bp}\end{array}\right]$$ (12)

whose eigenvalues are YuehCheng:2008 $\lambda_{k}=E^{bp}+2t^{bp}\textrm{cos}\theta_{k}$, $\theta_{k}=\frac{2k\pi}{N}$, $k=1,2,\dots,N$.

Having checked that the normalized eigenvectors $\vec{v_{k}}$ corresponding to the eigenvalues $\lambda_{k}$ of Eq. 10 are linearly independent, the solution of our problem is

$$\vec{x}(t)=\sum_{k=1}^{N}c_{k}\vec{v_{k}}e^{-\frac{i}{\hbar}\lambda_{k}t}.$$ (13)

The initial conditions used usually in this article are

$$\vec{x}(0)=\left[\begin{array}[]{c}A_{1}(0)\\ A_{2}(0)\\ \vdots\\ A_{N}(0)\end{array}\right]=\left[\begin{array}[]{c}1\\ 0\\ \vdots\\ 0\end{array}\right]$$ (14)

which means that we initially place the carrier in base-pair 1 and we want to see how the carrier will evolve, time passing. From the initial conditions we determine $c_{i}(t)$. In some cases, however, comparing with a particular experiment, we need to put the carrier initially at the base-pair indicated by the authors of the experimental work.

III Dimers, trimers and polymers

We emphasize that our calculations below refer to pure carrier transfer rates extracted from the probabilities to find the carrier at a particular monomer of interest after having placed it initially (for time zero) at another monomer, i.e. refer directly to the solution of Eq. (4). We do not take into account the influence of other factors such as the density of states, the environment etc.

III.1 Dimers

For any dimer, the solution of our problem is

$$\vec{x}(t)=\sum_{k=1}^{2}c_{k}\vec{v_{k}}e^{-\frac{i}{\hbar}\lambda_{k}t}.$$ (15)

Let us suppose that $\lambda_{2}\geq\lambda_{1}$. We are interested in the quantities $|A_{\mu}(t)|^{2},\mu=1,2$ (cf. Eq. 2 and Eq. 5) since they provide the probabilities of finding the carrier at the base-pair $\mu$. From Eq. 15, we obtain the period of $|A_{\mu}(t)|^{2},\mu=1,2$

$$T=\frac{h}{\lambda_{2}-\lambda_{1}}.$$ (16)

III.1.1 A dimer consisting of identical monomers

Maybe in the simplest case one could imagine, suppose that we have a dimer consisting of two identical monomers with purine on purine and pyrimidine on pyrimidine, i.e. GG $\equiv$ CC or AA $\equiv$ TT e.g.

$$5^{\prime} 3^{\prime}$$

G $$-$$ C

G $$-$$ C

$$3^{\prime} 5^{\prime}$$ (17)

so that

$$\textrm{A}=\left[\begin{array}[]{cc}E^{bp}&t^{bp}\\ t^{bp}&E^{bp}\end{array}\right]$$ (18)

with eigenvalues

$$\lambda_{1,2}=E^{bp}\mp t^{bp}$$ (19)

and corresponding normalized eigenvectors

$$\vec{v_{1}}=\left[\begin{array}[]{c}-\sqrt{2}/2\\ \sqrt{2}/2\end{array}\right],\vec{v_{2}}=\left[\begin{array}[]{c}\sqrt{2}/2\\ \sqrt{2}/2\end{array}\right].$$ (20)

Then, for initial condition

$$\vec{x}(0)=\left[\begin{array}[]{c}1\\ 0\end{array}\right],$$ (21)

$$\vec{x}(t)\!\!=\!\!\left[\begin{array}[]{c}A_{1}(t)\\ A_{2}(t)\end{array}\right]\!\!=\!\!\left[\begin{array}[]{r}\frac{1}{2}e^{-\frac{i}{\hbar}\lambda_{1}t}+\frac{1}{2}e^{-\frac{i}{\hbar}\lambda_{2}t}\\ -\frac{1}{2}e^{-\frac{i}{\hbar}\lambda_{1}t}+\frac{1}{2}e^{-\frac{i}{\hbar}\lambda_{2}t}\end{array}\right].$$ (22)

We are interested in the quantities $|A_{\mu}(t)|^{2},\mu=1,2$ since they provide the probabilities of finding the carrier at the base-pair $\mu$. From Eq. 22 we obtain

$$\left[\begin{array}[]{c}|A_{1}(t)|^{2}\\ |A_{2}(t)|^{2}\end{array}\right]=\left[\begin{array}[]{r}\frac{1}{2}+\frac{1}{2}\textrm{cos}[\frac{(\lambda_{2}-\lambda_{1})t}{\hbar}]\\ \frac{1}{2}-\frac{1}{2}\textrm{cos}[\frac{(\lambda_{2}-\lambda_{1})t}{\hbar}]\end{array}\right].$$ (23)

Next, suppose that we have a dimer consisting of two identical monomers with purine on pyrimidine and vice versa, i.e., GC or CG or AT or TA, e.g.

$$5^{\prime} 3^{\prime}$$

G $$-$$ C

C $$-$$ G

$$3^{\prime} 5^{\prime}$$ (24)

In these cases the matrix A is given again by Eq. 18 i.e. the problem is identical to the previous one.

III.1.2 A dimer consisting of different monomers

Suppose now that we have a dimer made up of two different monomers i.e. AG $\equiv$ CT, AC $\equiv$ GT, TG $\equiv$ CA, TC $\equiv$ GA, e.g.

$$5^{\prime} 3^{\prime}$$

G $$-$$ C

A $$-$$ T

$$3^{\prime} 5^{\prime}.$$ (25)

Then,

$$\textrm{A}=\left[\begin{array}[]{cc}E^{bp1}&t^{bp}\\ t^{bp}&E^{bp2}\end{array}\right]$$ (26)

with eigenvalues

$$\lambda_{1,2}=\frac{E^{bp1}+E^{bp2}}{2}\mp\sqrt{\frac{(E^{bp1}-E^{bp2})^{2}}{4}+{t^{bp}}^{2}}.$$ (27)

Eq. 19 is a special case of Eq. 27 for $E^{bp1}=E^{bp2}$.

III.1.3 Period, maximum transfer percentage, pure maximum transfer rate

If the dimer is made up of identical monomers (different monomers), the eigenvalues are given by Eq. 19 (Eq. 27). Let us define $\Delta^{bp}=|E^{bp1}-E^{bp2}|$. In the special case $\lambda_{2}=\lambda_{1}\Leftrightarrow[t^{bp}=0\textrm{ and }\Delta^{bp}=0]$ (cf. Eq. 19 and Eq. 27), $T\to\infty$, i.e. the functions are constant. Using Eq. 19 for identical monomers

$$T=\frac{h}{2|t^{bp}|}.$$ (28)

Using Eq. 27 for different monomers

$$T=\frac{h}{\sqrt{(2t^{bp})^{2}+(\Delta^{bp})^{2}}}.$$ (29)

The former Eq. 28 is a special case of the latter Eq. 29 for $E^{bp1}=E^{bp2}$. Hence, in the case of identical monomers the period depends only on the hopping parameter between the base-pairs, but in the case of different monomers the period depends additionally on the energy gap between the on-site energies of the carrier in the different monomers.

From Eq. 15 we obtain the maximum transfer percentage of the carrier from base-pair 1 to base-pair 2, $p=4c_{1}v_{11}c_{2}v_{12}$. This refers to the maximum of $|A_{2}(t)|^{2}$. $v_{ij}$ is the $i$-th component of eigenvector $j$. The maximum transfer percentage reads

$$p=\frac{(2t^{bp})^{2}}{(2t^{bp})^{2}+(\Delta^{bp})^{2}}.$$ (30)

Hence, for identical monomers, it follows that $p=1$, while for different monomers $p<1$.

The pure maximum transfer rate can be defined as

$$\frac{p}{T}=\frac{(2t^{bp})^{2}}{h\sqrt{(2t^{bp})^{2}+(\Delta^{bp})^{2}}}.$$ (31)

Hence, for identical monomers, it follows that

$$\frac{p}{T}=\frac{2|t^{bp}|}{h}.$$ (32)

For a dimer consisting of two identical monomers with purine on purine and pyrimidine on pyrimidine, as mentioned above, the period of $|A_{\mu}(t)|^{2},\mu=1,2$ is given by Eq. 28. In all cases, the maximum transfer percentage, $p=1$ (100%). For a dimer consisting of two identical monomers with purine on pyrimidine and vice versa, again, we use Eq. 28. In all cases, the maximum transfer percentage, $p=1$ (100%). Conclusively, for all cases of a dimer consisting of two identical monomers, the maximum transfer percentage $p=1$ (100%).

For a dimer made up of two different monomers we use Eq. 29. In contrast to the case of identical monomers the maximum transfer percentage $p<1$. For holes, when purines are crosswise to pyrimidines (GT $\equiv$ AC and CA $\equiv$ TG dimers) the maximum transfer percentage is negligible. Also AG $\equiv$ CT has very small $p$. For electrons, again, we observe that in contrast to the case of identical monomers the maximum transfer percentage $p<1$. Additionally, generally, electrons have smaller maximum transfer percentages than holes. However, in contrast to the cases of holes, mentioned just above, when purines are NOT crosswise to pyrimidines (GA $\equiv$ TC and CT $\equiv$ AG) the maximum transfer percentage is negligible. Generally, in cases of different monomers $T$ is smaller than in cases of identical monomers due to difference between Eq. 29 and Eq. 28, i.e. the extra term containing $\Delta^{bp}=|E^{bp1}-E^{bp2}|$. Overall, carrier transfer is more difficult for different monomers compared to identical monomers.

III.1.4 Dimer pure mean transfer rates and other quantities

If initially i.e. for $t=0$ we place the carrier at the first monomer (Eq. 14), then $|A_{1}(0)|^{2}=1$, $|A_{2}(0)|^{2}=0$. Hence, a pure mean transfer rate can be defined as

$$k=\frac{\langle|A_{2}(t)|^{2}\rangle}{{t_{2}}_{mean}},$$ (33)

where ${t_{2}}_{mean}$ is the first time $|A_{2}(t)|^{2}$ becomes equal to $\langle|A_{2}(t)|^{2}\rangle$ i.e. “the mean transfer time”. This definition as well as the analogous definitions for trimers (Eq. 45) and polymers (Eq. 46) take into account not only the transfer time but also the mean magnitude of charge transfer expressed by $\langle|A_{\mu}(t)|^{2}\rangle$. Figure 1 shows quantities relevant to the periodic carrier transfer in a base-pair dimer, specifically, the hopping integrals $t_{H/L}^{bp\;\textrm{used}}$, the period of carrier transfer between monomers $T$ and the maximum transfer percentage $p$, the pure maximum transfer rate defined as $p/T$ and the pure mean transfer rate defined as $k=\langle|A_{2}(t)|^{2}\rangle/{t_{2}}_{mean}$, as well as $\langle|A_{\mu}(t)|^{2}\rangle,\;\mu=1,2$, which describe the spread of the carrier over the monomers constituting the dimer. For the dimers made up of identical monomers $p=1$ whereas for the dimers made up of different monomers $p<1$. In the latter case, the pure maximum transfer rate and the pure mean transfer rate are negligible for HOMO hole transfer when purines are crosswise to pyrimidines (GT $\equiv$ AC and CA $\equiv$ TG dimers) and for LUMO electron transfer when purines are on top of pyrimidines (GA $\equiv$ TC and CT $\equiv$ AG dimers). For dimers $k=2\frac{p}{T}$.

Figure 1: Periodic carrier transfer in a base-pair dimer for holes (left column) and electrons (right column). The hopping integrals $t_{H/L}^{bp\;\textrm{used}}$ (meV) [1st row], the period of carrier transfer between monomers $T$ (fs) and the maximum transfer percentage $p$ [2nd row], the pure maximum transfer rate defined as $p/T$ (PHz) and the pure mean transfer rate defined as $k=\langle|A_{2}(t)|^{2}\rangle/{t_{2}}_{mean}$ (PHz) [3rd row], as well as $\langle|A_{\mu}(t)|^{2}\rangle,\;\mu=1,2$, which describe the spread of the carrier over the monomers constituting the dimer [4th row], are shown. For the dimers made up of identical monomers $p=1$ whereas for the dimers made up of different monomers $p<1$. In the latter case, the pure maximum transfer rate and the pure mean transfer rate are negligible for HOMO hole transfer when purines are crosswise to pyrimidines (GT $\equiv$ AC and CA $\equiv$ TG dimers) and for LUMO electron transfer when purines are on top of pyrimidines (GA $\equiv$ TC and CT $\equiv$ AG dimers). For dimers $k=2\frac{p}{T}$.

III.2 Trimers

For any trimer, the solution of our problem is

$$\vec{x}(t)=\sum_{k=1}^{3}c_{k}\vec{v_{k}}e^{-\frac{i}{\hbar}\lambda_{k}t}.$$ (34)

Let us suppose further that $\lambda_{1}\leq\lambda_{2}\leq\lambda_{3}$. We are interested in the quantities $|A_{\mu}(t)|^{2},\mu=1,2,3$ (cf. Eq. 2 and Eq. 5) since they provide the probabilities of finding the carrier at the base-pair $\mu$. From Eq. 34, we conclude that $|A_{\mu}(t)|^{2},\mu=1,2,3$ are sums of terms containing constants and periodic functions with periods

$$T_{21}=\frac{h}{\lambda_{2}-\lambda_{1}},\\ T_{32}=\frac{h}{\lambda_{3}-\lambda_{2}},\\ T_{31}=\frac{h}{\lambda_{3}-\lambda_{1}}.$$ (35)

In case of double degeneracy, e.g. $\lambda_{2}=\lambda_{1}\Rightarrow T_{21}\to\infty$, i.e. the terms containing $T_{21}$ are constant and the only period that remains is $T_{32}=T_{31}$, hence $|A_{\mu}(t)|^{2},\mu=1,2,3$ are periodic. In case of triple degeneracy, $\lambda_{3}=\lambda_{2}=\lambda_{1}$ all periods are infinite, hence $|A_{\mu}(t)|^{2},\mu=1,2,3$ are constants.

III.2.1 A trimer consisting of identical monomers

There are 8 such trimers, 4 based on G-C monomers [GGG $\equiv$ CCC (0 times crosswise purines), GGC $\equiv$ GCC (1 time crosswise purines), CGG $\equiv$ CCG (1 time crosswise purines), GCG $\equiv$ CGC (2 times crosswise purines)], and 4 based on A-T monomers [AAA $\equiv$ TTT (0 times crosswise purines), AAT $\equiv$ ATT (1 time crosswise purines), TAA $\equiv$ TTA (1 time crosswise purines), ATA $\equiv$ TAT (2 times crosswise purines)].

In the cases of 0 times crosswise purines

$$\textrm{A}=\left[\begin{array}[]{ccc}E^{bp}&t^{bp}&0\\ t^{bp}&E^{bp}&t^{bp}\\ 0&t^{bp}&E^{bp}\end{array}\right]$$ (36)

with eigenvalues

$$\lambda_{2}=E^{bp},\;\;\;\;\;\lambda_{1,3}=E^{bp}\mp t^{bp}\sqrt{2}.$$ (37)

Hence, two periods are involved in $|A_{\mu}(t)|^{2},\mu=1,2,3$:

$$T_{M}=\frac{h}{t^{bp}\sqrt{2}},\;\;\;\;\;T_{E}=\frac{h}{2t^{bp}\sqrt{2}}\;\;\Rightarrow\;\;\frac{T_{M}}{T_{E}}=\frac{2}{1}.$$ (38)

$T_{M}=T_{M(21)}=T_{M(32)}$ involves the Medium eigenvalue, $T_{E}=T_{E(31)}$ involves only the Edge eigenvalues. Since $\frac{T_{M}}{T_{E}}=\frac{2}{1}$ it follows that $|A_{\mu}(t)|^{2},\mu=1,2,3$ are periodic.

In the cases of 1 or 2 times crosswise purines

$$\textrm{A}=\left[\begin{array}[]{ccc}E^{bp}&t^{bp}&0\\ t^{bp}&E^{bp}&t^{bp^{\prime}}\\ 0&t^{bp^{\prime}}&E^{bp}\end{array}\right]$$ (39)

with eigenvalues

$$\lambda_{2}=E^{bp},\;\;\;\;\;\lambda_{1,3}=E^{bp}\mp\sqrt{{t^{bp}}^{2}+{t^{bp^{\prime}}}^{2}}.$$ (40)

Hence, two periods are involved in $|A_{\mu}(t)|^{2},\mu=1,2,3$:

$$T_{M}=\frac{h}{\sqrt{{t^{bp}}^{2}+{t^{bp^{\prime}}}^{2}}},T_{E}=\frac{h}{2\sqrt{{t^{bp}}^{2}+{t^{bp^{\prime}}}^{2}}}\Rightarrow\frac{T_{M}}{T_{E}}=\frac{2}{1}.$$ (41)

Again, since $\frac{T_{M}}{T_{E}}=\frac{2}{1}$ it follows that $|A_{\mu}(t)|^{2},\mu=1,2,3$ are periodic.

Conclusively, in all cases of a trimer consisting of identical monomers, $|A_{\mu}(t)|^{2},\mu=1,2,3$ are periodic with period $T_{M}$.

III.2.2 A trimer consisting of different monomers

Suppose that we have a trimer consisting of different monomers. There are 24 different such trimers: GGA $\equiv$ TCC, GGT $\equiv$ ACC, GCA $\equiv$ TGC, GCT $\equiv$ AGC, GAG $\equiv$ CTC, GAC $\equiv$ GTC, GAA $\equiv$ TTC, GAT $\equiv$ ATC, GTG $\equiv$ CAC, GTA $\equiv$ TAC, GTT $\equiv$ AAC, CGA $\equiv$ TCG, CGT $\equiv$ ACG, CCA $\equiv$ TGG, CCT $\equiv$ AGG, CAG $\equiv$ CTG, CAA $\equiv$ TTG, CAT $\equiv$ ATG, CTA $\equiv$ TAG, AGA $\equiv$ TCT, AGT $\equiv$ ACT, ACA $\equiv$ TGT, TGA $\equiv$ TCA, CTT $\equiv$ AAG. For example, suppose that we refer to HOMO charge transfer in GAC $\equiv$ GTC, then

$$\textrm{A}=\left[\begin{array}[]{ccc}E^{bp}&t^{bp}&0\\ t^{bp}&E^{bp^{\prime\prime}}&t^{bp^{\prime}}\\ 0&t^{bp^{\prime}}&E^{bp}\end{array}\right]$$ (42)

where $E^{bp^{\prime\prime}}>E^{bp}$, and the eigenvalues are

$$\lambda_{2}=E^{bp},$$ (43)

$$\lambda_{1,3}\!=\!\frac{E^{bp}+E^{bp^{\prime\prime}}}{2}\!\mp\!\sqrt{\left(\frac{E^{bp}-E^{bp^{\prime\prime}}}{2}\right)^{2}\!+\!{t^{bp}}^{2}+{t^{bp^{\prime}}}^{2}}.$$

Hence, three periods are involved in $|A_{\mu}(t)|^{2},\mu=1,2,3$. Defining $\Delta^{bp}=|E^{bp}-E^{bp^{\prime\prime}}|$,

$$T_{M(32)}=\frac{h}{\frac{\Delta^{bp}}{2}\!+\!\sqrt{\frac{{\Delta^{bp}}^{2}}{4}\!+\!{t^{bp}}^{2}+{t^{bp^{\prime}}}^{2}}},$$ (44)

$$T_{E(31)}=\frac{h}{2\sqrt{\frac{{\Delta^{bp}}^{2}}{4}\!+\!{t^{bp}}^{2}+{t^{bp^{\prime}}}^{2}}},$$

$$T_{M(21)}=\frac{h}{-\frac{\Delta^{bp}}{2}\!+\!\sqrt{\frac{{\Delta^{bp}}^{2}}{4}\!+\!{t^{bp}}^{2}+{t^{bp^{\prime}}}^{2}}}$$

Therefore, $\frac{T_{M(32)}}{T_{E(31)}}$ and $\frac{T_{M(21)}}{T_{E(31)}}$ may be irrational numbers, hence $|A_{\mu}(t)|^{2},\mu=1,2,3$ may be non periodic.

III.2.3 Trimer pure mean transfer rates and other quantities

Figure 2: The HOMO pure mean transfer rate $k$ for all possible trimers as well as $\langle|A_{\mu}(t)|^{2}\rangle,\;\mu=1,2,3$, which describe the spread of the hole over the monomers constituting the trimer. The trimers are shown in descending HOMO $k$ order. Initially, we place the hole in monomer 1.

The calculations show that for trimers consisting of identical monomers $k\approx 1.3108\frac{p}{T}$. However, since for trimers consisting of different monomers $|A_{\mu}(t)|^{2},\mu=1,2,3$ may be non periodic, from now on we will use only the pure mean transfer rate $k$. Assuming that initially i.e. for $t=0$ we place the carrier at the first monomer (Eq. 14), then $|A_{1}(0)|^{2}=1$, $|A_{2}(0)|^{2}=0$, $|A_{3}(0)|^{2}=0$. Hence, a pure mean transfer rate can be defined as

$$k=\frac{\langle|A_{3}(t)|^{2}\rangle}{{t_{3}}_{mean}},$$ (45)

where ${t_{3}}_{mean}$ is the first time $|A_{3}(t)|^{2}$ becomes equal to $\langle|A_{3}(t)|^{2}\rangle$ i.e. “the mean transfer time”.

The HOMO pure mean transfer rate $k$ for all possible trimers as well as $\langle|A_{\mu}(t)|^{2}\rangle,\;\mu=1,2,3$, which describe the spread of the hole over the monomers constituting the trimer are shown in Figure 2. As expected, $k$ is very small when trimers include dimers with very small $k$, primarily purines crossswise to pyrimidines (GT $\equiv$ AC, CA $\equiv$ TG), secondarily AG $\equiv$ CT, and thirdly GC. We underline that in some cases $k$ is very small due to the very large value of the mean transfer time although finally the carrier may have an appreciable or even remarkable occupancy of the last monomer. For example, in GTG$\equiv$CAC and in ACA$\equiv$TGT, $|A_{3}(t)|^{2}\approx 0.4989$, although $k\approx 3.2\times 10^{-4}$. This remark, displayed here for trimers, holds also for polymers and one should not forget it when comparing with results from different experimental techniques.

The LUMO pure mean transfer rate $k$ for all possible trimers as well as $\langle|A_{\mu}(t)|^{2}\rangle,\;\mu=1,2,3$, which describe the spread of the electron over the monomers constituting the trimer are shown in Figure 3.

Figure 3: The LUMO pure mean transfer rate $k$ for all possible trimers as well as $\langle|A_{\mu}(t)|^{2}\rangle,\;\mu=1,2,3$, which describe the spread of the electron over the monomers constituting the trimer. The trimers are still shown in descending HOMO $k$ order, as in Fig. 2. Initially, we place the electron in monomer 1.

III.3 Polymers

Supposing that initially i.e. for $t=0$ we place the carrier at the first monomer (Eq. 14), then $|A_{1}(0)|^{2}=1$, while all other $|A_{j}(0)|^{2}=0$, $j=2,\dots,N$. Hence, for a polymer consisting of $N$ monomers, a pure mean transfer rate can be defined as

$$k=\frac{\langle|A_{N}(t)|^{2}\rangle}{{t_{N}}_{mean}},$$ (46)

where ${t_{N}}_{mean}$ is the first time $|A_{N}(t)|^{2}$ becomes equal to $\langle|A_{N}(t)|^{2}\rangle$ i.e. “the mean transfer time”.

Below, increasing the number of base-pairs or monomers $N$, we study various characteristic polymers: poly(dG)-poly(dC), poly(dA)-poly(dT), GCGCGC…, CGCGCG…, ATATAT…, TATATA… as well as DNA segments that have been experimentally studied in the past. As usual, we only write down the 5’- 3’ DNA strand. If we fit $k(d)$ –i.e. the pure mean transfer rate $k$ as a function of the charge transfer distance $d=N\times$ 3.4 Å– exponentially, as $k=k_{0}\textrm{exp}(-\beta d)$, we obtain an estimation of $k_{0}$ and of the distance dependence parameter or inverse decay length $\beta$ Marcus . These quantities are displayed in Table 3. If, instead, we fit $k(N)$ –i.e. the pure mean transfer rate $k$ as a function of the number of monomers $N$– in a power law, as $k=k_{0}^{\prime}N^{-\eta}$, we obtain an estimation of $k_{0}^{\prime}$ and $\eta$. These quantities are displayed in Table 4. Values of $\beta$, in the range $\approx$ 0.3-1.5 Å^-1, for various compounds, have been displayed in the literature at least 30 years now, see e.g Table IV of Ref. Marcus . In Table 3 the values of $\beta$ are in the range $\approx$ 0.2-2 Å^-1, with smaller values for periodic polymers like ATATAT…, poly(dG)-poly(dC), poly(dA)-poly(dT). However, for efficient charge transfer, a small value of $\beta$ is not enough; one should also take into account the magnitude of $k_{0}$. The values of $k_{0}$ assumed in Ref. Marcus are 10^-2-10^-1 PHz which coincides with most of the $k_{0}$ values shown in Table 3, although generally, the values of $k_{0}$ fall in the wider range $\approx 10^{-4}$-10 PHz. For the power law fit, $\eta\approx$ 1.7 - 17; most of the $k_{0}^{\prime}$ values shown in Table 4 are in the range $\approx 10^{-2}$-10^-1 PHz, although generally, the values of $k_{0}^{\prime}$ fall in the wider range $\approx 10^{-4}$-10³ PHz. The $\beta$-value for charge transfer from an initial site (donor) to a final site (acceptor) depends on the mediating molecules, the so-called bridge. From Table 3 we conclude that there are no universal (even approximately) values of $\beta$ and $k_{0}$ for DNA, instead, each specific DNA segment is unique and one should use an efficient and easy way to predict $\beta$ and $k_{0}$ of each DNA segment under investigation. It is hoped that the present work will contribute in this direction. $\beta$ values for different systems include $\approx$ 1.0 - 1.4 Å^-1 for protein-bridged systems WinklerGray:1992 ; Moser:1992 ; GrayWinkler:2005 , $\approx$ 1.55 - 1.65 Å^-1 for aqueous glass bridges GrayWinkler:2005 , $\approx$ 0.2 - 1.4 Å^-1 for DNA segments Lewis:1997 ; Holmlin:1998 ; Henderson:1999 ; Wan:2000 ; KawaiMajima:2013 ; KalosakasSpanou:2013 , $\approx$ 0.8 - 1.0 Å^-1 for saturated hydrocarbon bridges Johnson:1989 ; Oevering:1987 , $\approx$ 0.2 - 0.6 Å^-1 for unsaturated phenylene Helms:1992 ; Ribou:1994 , polyene Arrhenius:1986 ; Effenberger:1991 ; Tolbert:1992 and polyyne Tour:1996 ; Grosshenny:1996 ; Sachs:1997 bridges, and much smaller values ($<$ 0.05 Å^-1), suggesting a molecular-wire-like behavior, for a p-phenylenevinylene bridge Davis:1998 . Hence, it seems that charge transfer in ATATAT…, poly(dG)-poly(dC) and poly(dA)-poly(dT) is almost molecular-wire-like. Since a carrier can migrate along DNA over 200 Å Meggers:1998 ; Henderson:1999 ; KawaiMajima:2013 , in the present calculations for polymers $d$ is extending up to 204 Å ($N$ up to 60 base-pairs).

Table 3: Estimated $k_{0}$ and $\beta$ of the exponential fit $k=k_{0}\textrm{exp}(-\beta d)$ for various DNA polymers.

DNA segment	$k_{0}$ (PHz)	$\beta$ (Å-1)	Correlation	H/L
			Coefficient
poly(dG)-poly(dC)	0.176 $\pm$ 0.007	0.189 $\pm$ 0.008	0.988	H
poly(dG)-poly(dC)	0.035 $\pm$ 0.001	0.189 $\pm$ 0.007	0.989	L
poly(dA)-poly(dT)	0.035 $\pm$ 0.001	0.189 $\pm$ 0.008	0.988	H
poly(dA)-poly(dT)	0.051 $\pm$ 0.002	0.189 $\pm$ 0.008	0.989	L
GCGCGC…	0.032 $\pm$ 0.003	0.358 $\pm$ 0.023	0.988	H
ATATAT…	0.057 $\pm$ 0.002	0.168 $\pm$ 0.008	0.985	H
CGCGCG…	0.932 $\pm$ 0.233	0.871 $\pm$ 0.074	0.994	H
TATATA…	0.110 $\pm$ 0.005	0.251 $\pm$ 0.012	0.985	H
AGTGCCAAGCTTGCA Murphy:1993	0.059 $\pm$ 0.002	0.685 $\pm$ 0.008	1.000	H
AGTGCCAAGCTTGCA Murphy:1993	$(9.8\!\pm\!2.6)\!\!\times\!\!10^{-5}$	0.197 $\pm$ 0.059	0.808	L
TAGAGGTGTTATGA VariationWan:2000	4.306 $\pm$ 5.001	1.321 $\pm$ 0.342	0.998	H
TAGAGGTGTTATGA VariationWan:2000	2.877 $\pm$ 0.833	2.154 $\pm$ 0.085	1.000	L

Table 4: Estimated $k_{0}^{\prime}$ and $\eta$ of the power fit $k=k_{0}^{\prime}N^{-\eta}$ for various DNA polymers.

DNA segment	$k_{0}^{\prime}$ (PHz)	$\eta$	Correlation	H/L
			Coefficient
poly(dG)-poly(dC)	0.359 $\pm$ 0.001	1.893 $\pm$ 0.002	1.000	H
poly(dG)-poly(dC)	0.072 $\pm$ 0.000	1.895 $\pm$ 0.002	1.000	L
poly(dA)-poly(dT)	0.072 $\pm$ 0.000	1.892 $\pm$ 0.002	1.000	H
poly(dA)-poly(dT)	0.105 $\pm$ 0.000	1.893 $\pm$ 0.002	1.000	L
GCGCGC…	0.087 $\pm$ 0.008	3.176 $\pm$ 0.127	0.993	H
ATATAT…	0.117 $\pm$ 0.004	1.776 $\pm$ 0.035	0.994	H
CGCGCG…	5.082 $\pm$ 1.619	6.715 $\pm$ 0.458	0.994	H
TATATA…	0.236 $\pm$ 0.007	2.295 $\pm$ 0.035	0.997	H
AGTGCCAAGCTTGCA Murphy:1993	1.383 $\pm$ 0.826	4.487 $\pm$ 0.487	0.997	H
AGTGCCAAGCTTGCA Murphy:1993	$(2.2\!\pm\!1.0)\!\!\times\!\!10^{-4}$	2.176 $\pm$ 0.543	0.761	L
TAGAGGTGTTATGA VariationWan:2000	46.300 $\pm$53.288	9.902 $\pm$ 1.660	0.998	H
TAGAGGTGTTATGA VariationWan:2000	203.457$\pm$99.552	16.708 $\pm$ 0.706	1.000	L

As an example, details of calculations for charge transfer in poly(dG)-poly(dC) are given in this paragraph. The relevant quantities are shown in Figure 4. Let’s define the Edge Group of monomers made up of the first and the last monomer, and the Middle Group of monomers made up of the rest of the monomers. The numerical calculations show that as a function of the total number of monomers (base-pairs), $N$, the total probability at the Edge Group, is given by $e(N)=\frac{3}{N+1}$, and of course the total probability at the Middle Group, $m(N)=1-e(N)$. For poly(dG)-poly(dC) these probabilities are equally distributed among the members of the Edge Group and the Middle Group. These quantities are displayed in the first two rows of Figure 4. Next, the pure mean transfer rate $k$ as a function of the distance from the first to the last monomer i.e. the charge transfer distance $d=N\times$ 3.4 Å is displayed in the third row. Finally, one could define the speed of charge transfer as $u=kd$, displayed in the last row. Supposing that the pure mean transfer rate $k$ follows an exponential dependence on the charge transfer distance $d$, and fitting as $k=k_{0}\textrm{exp}(-\beta d)$, an estimation of $\beta$ and $k_{0}$ is obtained.

Figure 4: Hole (left column) and electron (right column) transfer in poly(dG)-poly(dC). [1st row] The total probability at the Edge Group, $e(N)=\frac{3}{N+1}$, and the total probability at the Middle Group, $m(N)=1-e(N)$. [2nd row] In poly(dG)-poly(dC) these probabilities are equally distributed among the members (monomers) of these Groups. The probability at each of the members of the Groups is shown. [3rd row] The pure mean transfer rate $k$ as a function of the distance from the first to the last monomer i.e. the charge transfer distance $d=N\times$ 3.4 Å. [4th row] The speed of charge transfer defined as $u=kd$.

In Fig. 5 a few aspects of hole transfer in TATATA… are displayed.

Figure 5: Hole transfer in TATATA…. [1st panel] The total probability at the Edge Group and the total probability at the Middle Group. [2nd panel] The pure mean transfer rate $k$ as a function of the distance from the first to the last monomer i.e. the charge transfer distance $d=N\times$ 3.4 Å. [3rd panel] The speed of charge transfer $u=kd$.

In Reference WangLewisSankey:2004 the authors calculated the complex band structure of poly(dA)-poly(dT) and poly(dG)-poly(dC) and obtained the energy dependence $\beta(E)$. They also found the bang gap of poly(dA)-poly(dT) (2.7 eV) and of poly(dG)-poly(dC) (2.0 eV) in accordance with previous works. Within the fundamental band gap between valence and conduction band i.e. HOMO and LUMO in our approach, they found several $\beta(E)$ curves. Since the states with large $\beta$ values do not play a significant role in conduction they noticed that only the smallest $\beta(E)$ states, described by a semielliptical-like curve in the band-gap energy region are important. This branch reaches a maximum $\beta$ value near midgap, called the branch point, $\beta_{bp}$, approximately equal to 1.5 Å^-1 for both poly(dA)-poly(dT) and poly(dG)-poly(dC). Since in molecular electronics metallic contacts are made at the two ends of the molecule and electronic current is carried by electrons tunneling from the metal with energies in the band-gap region, the branch point plays an important role in the analysis of the conductance. Although the above may hold when metal conducts are attached to the molecule, in photoinduced charge transfer experiments, we are interested in states close to the top of the valence band i.e. the HOMO or close to the bottom of the conduction band i.e. the LUMO. As far as one can judge from the figures, for the top of the valence band of poly(dA)-poly(dT) [Fig.1a of Ref. WangLewisSankey:2004 ] $\beta\approx$ 0.4 Å^-1 and for poly(dG)-poly(dC) [Fig.1b of Ref. WangLewisSankey:2004 ] $\beta\approx$ 0.2 Å^-1. These values are close to the values predicted in the present work ($\approx$ 0.2 Å^-1 both for poly(dA)-poly(dT) and poly(dG)-poly(dC) cf. Table 3). For the bottom of the conduction band of poly(dA)-poly(dT) [Fig.1a of Ref. WangLewisSankey:2004 ] $\beta\approx$ 0.5 Å^-1 and for poly(dG)-poly(dC) [fig.1b of Ref. WangLewisSankey:2004 ] $\beta\approx$ 0.7 Å^-1. On the contrary, the values predicted in the present work are $\approx$ 0.2 Å^-1 both for poly(dA)-poly(dT) and poly(dG)-poly(dC) cf. Table 3. Maybe this difference is related to the fact that in Ref. WangLewisSankey:2004 , the complex band structure is calculated using an ab initio tight-binding method based on density-functional theory, while, from our point of view, we expect no difference in the $\beta$ both for poly(dA)-poly(dT) and poly(dG)-poly(dC) and both for the HOMO or the LUMO since all these are the same type of polymers with just a different strength of interaction between the constituting monomers (hence the $k_{0}$ values are different and proportional to the corresponding hopping parameters).

In Reference Giese:2001 Giese et al. studied experimentally the hole transfer in the DNA segment [G] (T)n [GGG] TATTATATTACGC. (T)n denotes the bridge made up from $n$ T-A monomers between the hole donor G (the first G-C monomer) and the hole acceptor GGG (the trimer made by G-C monomers) before the TATTATATTACGC tail. The hole donor and acceptor are denoted by square brackets. In Fig. 6 the computed $k(d)$ i.e. the pure mean transfer rate as a function of the distance from the hole donor to the middle of the hole acceptor is shown. In accordance with the experiment Giese:2001 we observe two regions with different distance dependence. For $n=1,2,3$ the distance dependence is strong becoming much weaker for $n\geq 4$. For the strong distance dependence range, we find $\beta\approx$ 0.8 Å^-1. In the experiment [Figure 3 of Ref. Giese:2001 ] the authors find qualitatively the same behavior, while they estimate $\beta\approx$ 0.6 Å^-1 for $n=1,2,3$. For $n=4,\dots,16$ a much weaker distance dependence is computed with $\beta\approx$ 0.07 Å^-1. Hence, the approach presented here explains the experimental results of Ref. Giese:2001 .

Figure 6: Experiment of Giese et al. Giese:2001 , i.e. [G] (T)n [GGG] TATTATATTACGC. (T)n denotes the bridge made up from $n$ T-A monomers between the hole donor G (the first G-C monomer) and the hole acceptor GGG (the trimer made by three G-C monomers) before the TATTATATTACGC tail. The hole donor and acceptor are denoted by square brackets. For the strong distance dependence $k(d)$ range (for $n=$ 1,2,3), $\beta\approx$ 0.8 Å^-1. In the experiment [Figure 3 of Ref. Giese:2001 ] the authors find qualitatively the same behavior, while they estimate $\beta\approx$ 0.6 Å^-1 for $n=1,2,3$ i.e. for the strong distance dependence range. For the weak distance dependence region, again in agreement with the experiment, a much weaker distance dependence with $\beta\approx$ 0.07 Å^-1 is obtained. The line is just guide for the eyes.

In Reference Murphy:1993 the authors demonstrated rapid photoinduced electron transfer over a distance of greater than 40 Å between metallointercalators that are tethered to the 5^′ termini of a 15-base-pair DNA duplex (5^′-AGTGCCAAGCTTGCA-3^′). The authors Murphy:1993 mentioned that “the photoinduced electron transfer between intercalators occurs very rapidly over $>$ 40 Å through the DNA helix over a pathway consisting of $\pi$-stacked base-pairs.” Then, from Marcus theory Marcus they estimated $\beta$ to be $\leq$ 0.2 Å^-1. We observe (Table 3) that for electron transfer (through LUMOs) we also find $\beta\leq$ 0.2 Å^-1, while for hole transfer (through HOMOs) we find $\beta\approx$ 0.7 Å^-1. Similar weak distance dependence with $\beta\leq$ 0.2 Å^-1 was found in Ref. Arkin:1996 .

Figure 7: Hole transfer in ACGCACGTCGCATAATATTACG [bridge] GGGTATTATATTACGC. The [bridge] is made up of TT dimers separated by G monomers. In the experiment Giese:1999 , [bridge] is either TT (one TT step) either TTGTT (two TT steps) or TTGTTGTTGTT (four TT steps). The hole is created in the C-G monomer before the G-C monomer before the [bridge], and transferred to the GGG trimer. Following Ref. Giese:1999 , the distance is measured from G₂₃ to the “left” G of GGG. $k_{\textrm{leftG}}$, $k_{\textrm{middelG}}$, and $k_{\textrm{rightG}}$ refer to the pure mean transfer rate of the first, second, and third G of GGG. The lines are just guides for the eyes.

In Reference Giese:1999 the authors study hole transfer in the DNA sequence ACGCACGTCGCATAATATTACG [bridge] GGGTATTATATTACGC, where the [bridge] is either TT (sample 1a, one TT step) either TTGTT (sample 2a, two TT steps) or TTGTTGTTGTT (sample 3a, four TT steps). Specifically, the hole is created in the C-G monomer before the G-C monomer before the [bridge] entity and the authors study its transfer to the GGG trimer. The charge transfer is measured by “the oxidative damage at the G and GGG units”, “quantified after piperidine treatment and polyacrylamide gel electrophoresis with a phospho-imager”. Hence to compare our results with the experiment we need the ratio of $\sum_{j}\langle|A_{j}(t)|^{2}\rangle$ where $j$ represents the three monomers of the GGG trimer to $\langle|A_{i}(t)|^{2}\rangle$ where $i$ represents the initial G-C monomer (called also G₂₃). This ratio is called GGGperG23 in Fig. 7. Our calculations with three or four TT steps confirm the experimental behavior either using an exponential fit with the $\beta$ parameter or a power law fit with the $\eta$ parameter. Extending the present approach up to eight TT steps reveals (Fig. 7) that there are two distinct regions (i) one step (S1) to two steps (S2), and (ii) more than two steps (up to eight steps are included in the graphs). Following Ref. Giese:1999 , in Fig. 7 the distance is measured from G₂₃ to the “left” G of GGG. In Fig. 7, $k_{\textrm{leftG}}$, $k_{\textrm{middelG}}$, and $k_{\textrm{rightG}}$ refer to the pure mean transfer rate of the first, second, and third G of GGG. Finally, we underline that a description based merely on relative occupancies like the ratio GGGperG23 (cf. Fig. 7 top and bottom panels), is not identical to a description based purely on transfer rates involving the time aspect (cf. Fig. 7 middle panel). Although rather obvious, this issue is obscure in the literature: often the exponential or the power fit are used either for the former or for the later case.

IV Conclusion

A handy method to examine the charge transfer properties of DNA segments has been displayed. It allows to illustrate to which extent a specific DNA segment can serve as an efficient medium for charge transfer. The temporal and spatial evolution of elctrons or holes along a $N$ base-pair DNA segment can be determined, solving a system of $N$ coupled differential equations. As input one needs the relevant on-site energies of the base-pairs and the hopping parameters between successive base-pairs. The method can be applied to any DNA segment. In the present manuscript, it has been applied to all possible dimers either for holes or for electrons, to all possible trimers for holes, and to various polymers (e.g. poly(dG)-poly(dC), poly(dA)-poly(dT), GCGCGC…, ATATAT…) either for electrons or holes. The results have been succesfully compared with results obtained by other workers, especially experimental ones. Some useful physical quantities were defined and calculated including the maximum transfer percentage $p$ and the pure maximum transfer rate $\frac{p}{T}$ for cases where a period $T$ can be defined, as well as the pure mean carrier transfer rate $k$ and the speed of charge transfer $u=kd$, where $d=N\times$ 3.4 Å is the charge transfer distance. Moreover, the inverse decay length $\beta$ used for the exponential fit $k=k_{0}\textrm{exp}(-\beta d)$ and the exponent $\eta$ used for the power law fit $k=k_{0}^{\prime}N^{-\eta}$ were computed. The values of these parameters are not universal but depend on the specific DNA segment and are also different for electrons and holes. Approximately, $\beta$ falls in the range $\approx$ 0.2 - 2 Å^-1, $k_{0}$ is usually 10^-2-10^-1 PHz although, generally, it falls in the wider range 10^-4-10 PHz, while $\eta$ falls in the range $\approx$ 1.7 - 17, $k_{0}^{\prime}$ is usually $\approx 10^{-2}$-10^-1 PHz, although generally, it falls in the wider range $\approx 10^{-4}$-10³ PHz.