\issuedate

Issue Date \issuenumberIssue Number

\contributor

Preprint; To be published in the Proceedings of the National Academy of Sciences of the United States of America;
Correspondence should be addressed to cluzel@mcb.harvard.edu

Environmental perturbations lift the degeneracy of the genetic code to regulate protein levels in bacteria

Arvind R. SubramaniamFAS Center for Systems Biology, Department of Molecular and Cellular Biology, and School of Engineering and Applied Sciences, Harvard University, 52 Oxford St, Cambridge, MA 02138, USA 1 Tao PanDepartment of Biochemistry and Molecular Biology, and Institute of Biophysical Dynamics, University of Chicago, Chicago, IL 60637, USA 2 Philippe Cluzel 1

(2012)

Abstract

The genetic code underlying protein synthesis is a canonical example of a degenerate biological system. Degeneracies in physical and biological systems can be lifted by external perturbations thus allowing degenerate systems to exhibit a wide range of behaviors. Here we show that the degeneracy of the genetic code is lifted by environmental perturbations to regulate protein levels in living cells. By measuring protein synthesis rates from a synthetic reporter library in Escherichia coli, we find that environmental perturbations, such as reduction of cognate amino acid supply, lift the degeneracy of the genetic code by splitting codon families into a hierarchy of robust and sensitive synonymous codons. Rates of protein synthesis associated with robust codons are up to hundred-fold higher than those associated with sensitive codons under these conditions. We find that the observed hierarchy between synonymous codons is not determined by usual rules associated with tRNA abundance and codon usage. Rather, competition among tRNA isoacceptors for aminoacylation underlies the robustness of protein synthesis. Remarkably, the hierarchy established using the synthetic library also explains the measured robustness of synthesis for endogenous proteins in E. coli. We further found that the same hierarchy is reflected in the fitness cost of synonymous mutations in amino acid biosynthesis genes and in the transcriptional control of sigma factor genes. Our study reveals that the degeneracy of the genetic code can be lifted by environmental perturbations, and it suggests that organisms can exploit degeneracy lifting as a general strategy to adapt protein synthesis to their environment.

^†^†volume: Volume

{article}

\abbreviations

AA, amino acid; CRI, codon robustness index

\dropcap

Degeneracy, the occurrence of distinct states that share a common function, is a ubiquitous property of physical and biological systems [1, 2, 3]. Examples of degenerate systems include atomic spectra [4], condensed matter [5], the nervous system [2] and the genetic code [6, 7]. Degeneracy in physical systems is often associated with underlying symmetries [1], and in biological systems with error-minimization, evolvability, and robustness against perturbations [8]. Degenerate states that are indistinguishable under normal conditions can exhibit distinct properties under the action of external perturbations [1]. This effect, called degeneracy lifting, allows degenerate systems to exhibit a wide range of behaviors depending on the environmental context [2]. The genetic code governing protein synthesis is a highly degenerate system since 18 of the 20 amino acids have multiple synonymous codons and 10 of the 20 amino acids are aminoacylated (charged) onto multiple tRNA isoacceptors. Protein synthesis rates in living cells respond to diverse environmental perturbations, which raises the question of whether any of these perturbations modulates protein levels by lifting the degeneracy of the genetic code. Previous experiments found that both the concentration of charged tRNAs as well as the occupancy of ribosomes on synonymous codons undergo significant changes upon nutrient limitation [9, 10, 60]. Yet whether such environmental perturbations lift the degeneracy of the genetic code by modulating the expression level of proteins is unknown. Here, we propose to use amino acid limitation in the bacterium Escherichia coli as a model system to investigate whether the degeneracy of the genetic code can be lifted by environmental perturbations, and how degeneracy lifting could provide a general strategy to adapt protein synthesis to environmental changes.

1 Results

1.1 Degeneracy lifting upon amino acid limitation

We considered synonymous codons for seven amino acids: Leu, Arg, Ser, Pro, Ile, Gln, and Phe. This set of seven amino acids is representative of the degeneracy of the genetic code, in that it includes six-, four-, three- and two-fold degenerate codon families. We constructed a library of 29 yellow fluorescent protein (yfp) gene variants, each of which had between six and eight synonymous mutations for one of the seven amino acids (Fig. 1A). In this library, we designed each yfp variant to characterize the effect of one specific codon on protein synthesis. We expressed the yfp variants constitutively at low gene dosage (2 copies / chromosome, Fig. 1B) in E. coli strains that were auxotrophic for one or more amino acids. We monitored growth and YFP synthesis in these strains during amino acid-rich growth as well as during limitation for each of the seven amino acids (Methods).

During amino acid-rich growth, our measurements revealed that protein synthesis rates were highly similar across yfp variants, with less than 1.4-fold variation within all codon families (Fig. 1D, grey bars). Thus, under rich conditions, the degeneracy of the genetic code remains intact with respect to protein synthesis. Strikingly, under amino acid-limited growth, codon families split into a hierarchy of YFP synthesis rates (Fig. 1C, 1D). We found that some synonymous codons, such as CTA for leucine, were highly sensitive to environmental perturbation, causing YFP synthesis rates to be near zero in response to the limitation of these codons’ cognate amino acids. Conversely, other synonymous codons, such as CTG for leucine, were more robust to the same perturbation with synthesis rates of YFP up to 100-fold higher than the sensitive ones¹¹1We define codons as robust when the synthesis rate from the corresponding yfp variant during cognate amino acid limitation is higher than the average synthesis rate within that codon family. Similarly, we define codons as sensitive when the synthesis rate from the corresponding yfp variant during cognate amino acid limitation is lower than the average synthesis rate within that codon family.. In addition to fluorescence, this difference in robustness was reflected in protein levels measured with Western blotting (Fig. S1). Notably, even a single substitution to a perturbation-sensitive codon in the yfp coding sequence resulted in more than a 2-fold difference in YFP synthesis rate during limitation for the cognate amino acid, without any effect on synthesis rate during amino acid-rich growth (Fig. S2). Only those codons that were cognate to the limiting amino acid caused splitting of YFP synthesis rates (Fig. S3). Interestingly, the splitting was more acute for codon families with six-fold degeneracy (Leu, Arg, Ser), while splitting was weaker for codon families with four-, three- and two-fold degeneracies (Fig. 1D, first row vs. second row). These results support the idea that greater degeneracy typically allows systems to exhibit wider range of responses to environmental perturbations [2]. In subsequent experiments, we focused on the two codon families, leucine and arginine that displayed the largest range of splitting. These two families constitute 16% of codons across the genome of E. coli.

1.2 Intracellular determinants of the hierarchy among synonymous codons

We sought to identify the intracellular parameters that determine the observed hierarchy of degeneracy splitting during amino acid limitation. To this end, we quantified the robustness of synthesis rate to amino acid limitation as the ratio of YFP synthesis rates between amino acid-limited and amino acid-rich growth phases. Protein synthesis rate is known to be correlated with codon usage and tRNA abundance during artificial over-expression of proteins [12, 13]. However, we found that robustness of YFP synthesis to amino acid limitation was not correlated with either codon usage or tRNA abundance ( $r^{2}=0.08$ and $0.00$ , squared Spearman rank-correlation, Fig. S4). We then considered determinants of protein synthesis that might be important specifically during amino acid limitation. tRNA isoacceptors are uniformly charged (aminoacylated) at about 80% under amino acid-rich conditions [14, 15]. However during perturbations such as amino acid limitation, some tRNA isoacceptors cognate to the amino acid are almost fully charged while other isoacceptors in the same family have charged fractions that are close to zero [10, 16]. A theoretical model proposed that such selective charging arises from differences in the relative supply and demand for charged tRNA isoacceptors [9]. While it is unclear how this mechanism could solely control protein levels, charged tRNA play an essential role as substrates for the elongation of ribosomes across individual codons [17]. Consequently, we hypothesized that selective charging of tRNA isoacceptors also underlies the observed splitting in synthesis rates among yfp variants. Consistent with this hypothesis, charged fractions of leucine and arginine tRNA isoacceptors during limitation of cognate amino acid starvation measured in a previous work [10] were correlated with the robustness of synthesis rates from yfp variants after accounting for codon-tRNA assignments ( $r^{2}=0.78$ , Fig. S5).

We experimentally tested whether varying the concentration of charged tRNA could change the hierarchy of protein synthesis rates initially revealed by amino acid limitation. To this end, we co-expressed each one of the leucine or arginine tRNA isoacceptors together with each of the six leucine or arginine variants of yfp, respectively (Fig. 2). Previous work [16] showed that overexpression of a single tRNA isoacceptor cognate to a limiting amino acid enables it to compete better in the common charging reaction against other isoacceptors. As a result, charged tRNA concentration of the overexpressed isoacceptor increases, while charged tRNA concentrations of the remaining isoacceptors for that amino acid decrease or remain unchanged [16]. We found that yfp variants constructed with perturbation-sensitive codons exhibited higher synthesis rates upon co-expression of tRNA isoacceptors cognate to those perturbation-sensitive codons (Fig. 2, A-B , bottom three rows, solid black-outlined squares). Conversely, yfp variants with perturbation-robust codons exhibited lower protein synthesis rates upon co-expression of non-cognate tRNA isoacceptors (Fig. 2, A-B, top three rows, non-outlined squares). These two patterns of changes in YFP synthesis rate mirror previously measured changes in charged tRNA concentration upon tRNA co-expression [16], thereby suggesting that the observed hierarchy in synthesis rates of yfp variants are tightly coupled with the concentrations of cognate charged tRNA isoacceptors during amino acid limitation. By contrast, tRNA co-expression did not affect synthesis rates from yfp variants in the absence of perturbation, i.e., during amino acid-rich growth (Fig. 2C). We observed several codon-tRNA pairs with mismatches at the wobble position but that do not satisfy known wobble-pairing rules (Table S9), and that showed an increase in YFP synthesis rate upon co-expression of the tRNA isoacceptor during amino acid limitation (Fig. 2, A-B , dashed black-outlined squares).

1.3 A codon robustness index for endogenous proteins

We investigated whether the hierarchy of synthesis rates measured for the synthetic yfp variants also governs the synthesis of endogenous proteins of E. coli. We first devised a general parameter, hereafter called the codon robustness index (CRI), to characterize the robustness of any protein’s synthesis rate to an environmental perturbation associated with limitation of a specific amino acid (Fig. 3A). We defined CRI as a product of codon-specific weights wcodon, and we inferred these weights from the synthesis robustness of yfp variants to limitation for their cognate amino acid (Fig. 3B). Our formulation of CRI is based on the simplifying assumption that each codon decreases protein synthesis rate by a factor $w_{codon}$ that is independent of the codon’s intragenic location, the presence of other codons in the coding sequence, or the specific cellular role of the encoded protein. By definition, $w_{codon}$ is unity for codons that are not cognate to the limiting amino acid, and perturbation-robust codons have a higher $w_{codon}$ value than perturbation-sensitive codons for the limiting amino acid.

To test the predictive power of CRI, we selected 92 E. coli open reading frames (ORFs) that span a broad range of leucine CRI values and functional categories (Fig. S7, Table LABEL:92orfs). We expressed the corresponding proteins constitutively as N-terminus fusions with YFP²²2The YFP fusion partner in the 92 ORF-yfp fusions used for testing Leu CRI was encoded by the CTG variant of yfp that has the highest, most robust synthesis rate during leucine limitation. Similarly, the YFP fusion partner in the 56 ORF-yfp fusions used for testing Arg CRI was encoded by the AGA variant of yfp that has the highest, most robust synthesis rate during arginine limitation. in an E. coli strain auxotrophic for leucine (Fig. 3C, Inset,). Upon leucine limitation, we found a strong correlation between the robustness of protein synthesis rates from the 92 ORF-yfp fusions and their leucine CRI values (Fig. 3C, $r^{2}=0.61$ , $P=10^{-23}$ , squared Spearman rank-correlation). Similarly, arginine CRI was also strongly correlated with robustness of a library of 56 ORF-yfp fusions during arginine limitation ( $r^{2}=0.59$ , $P=10^{-12}$ , Fig. S8, Table LABEL:56orfs). By contrast, standard measures of translation efficiency under amino acid-rich conditions such as codon adaptation index [18], tRNA adaptation index [19] or folding energy of the mRNA around the start codon [20] displayed only a weak correlation with protein synthesis rate from the ORF-yfp fusions during amino acid-rich growth ( $r^{2}=0.10$ , 0.08, and 0.02 resp., Fig. S9). We further found that changes in Leu CRI calculated from the yfp data could predict both the effect of tRNA co-expression and that of synonymous mutations on protein synthesis from E. coli ORFs during leucine limitation (Fig. 3D, Fig. S10). Importantly, similar to our results using yfp reporters, neither tRNA co-expression nor synonymous mutations for E.coli ORF-yfp fusions had a significant effect on the synthesis rates from these ORFs during leucine-rich growth in absence of environmental perturbations (Fig. S11). Thus the degeneracy of the genetic code underlies the levels of endogenous protein production only during response to environmental perturbations.

1.4 Consequences of degeneracy lifting for fitness and gene regulation

Degeneracy splitting in physical systems can be exploited to encode information related to the environmental context [21, 22]. We asked whether bacteria might similarly exploit the degeneracy splitting of genetic code during response to amino acid limitation. Hence we tested whether the expression of amino acid biosynthesis genes that enable bacteria to adapt to amino acid limitation is affected by the hierarchy between robust and sensitive codons. We found that mutating codons that are perturbation-robust to those that are perturbation-sensitive in the leucine-biosynthesis genes leuA, leuC and leuD, and the arginine biosynthetic gene carA decreased their protein synthesis rate during cognate amino acid limitation, but not during amino acid-rich growth (Fig. S12). Interestingly, in the case of leuA and carA, the same synonymous mutations also resulted in a fitness cost for prototrophic strains upon downshift from amino acid-rich to amino acid-poor conditions (Fig. 4A). Thus synonymous mutations can have a significant fitness cost during an environmental perturbation, which is distinct from that measured under nutrient-rich conditions in the absence of any perturbation [20, 23]. However swapping codons that are perturbation-robust to those that are perturbation-sensitive in other biosynthesis genes (see argA and leuC in Fig. 4A) did not significantly affect fitness, suggesting that the hierarchy of robust and sensitive codons might be selectively utilized by bacteria to regulate genes within a single metabolic pathway.

Perturbations associated with amino acid limitation in E. coli can result in two distinct outcomes, depending on the environmental conditions: On one hand, when substrates used in amino acid biosynthesis are still abundant in the environment, the cell up-regulates corresponding biosynthesis genes to mitigate the limitation of amino acids and resume growth. On the other hand, in the absence of substrates for amino acid biosynthesis, E. coli can survive a prolonged period in amino acid-poor environments through a cellular response mediated by sigma factors [24, 25]. We found that genes encoding several stress-response sigma factors (rpoS, rpoE and rpoH) are enriched in TTA and TTG, the leucine codons that ensure robust protein synthesis during leucine limitation (Fig. 4B, top panel). By contrast, genes for the housekeeping sigma factor (rpoD) and a few minor sigma factors (fecI, fliA) are enriched for CTC and CTT, which are sensitive to leucine limitation. This contrasting pattern is observed for leucine (but not for arginine), and is further mirrored by the change in transcript abundance for sigma factor genes in response to leucine limitation (Fig. 4B, bottom panel). Hence degeneracy splitting in the genetic code might be exploited in concert with transcriptional control to regulate protein levels.

2 Discussion

In summary, we have found that the degeneracy of the genetic code does not have a role in regulating protein synthesis during amino acid-rich growth. By contrast, the splitting of this degeneracy upon reduction in amino acid supply has a potent effect on protein synthesis that results in up to 100-fold differences in protein synthesis rates between synonymous gene variants. Such a large role for synonymous codons in protein synthesis is surprising given that other post-transcriptional mechanisms such as protein degradation are known to play a significant role upon amino acid limitation [26]. We identified competition between tRNA isoacceptors for aminoacylation as a key determinant of the hierarchy of protein synthesis rates during amino acid limitation. Low concentration of a charged tRNA isoacceptor can cause ribosomes to selectively pause at its cognate codon³³3A recent genome-wide study found increased ribosome pausing at serine codons during serine-limited growth of E. coli. Interestingly, ribosomes paused significantly only at four out of the six serine codons, and these four codons are precisely the same ones that caused YFP synthesis rate to be sensitive to serine limitation in our experiments (Fig. S13). and trigger ribosome jamming [27], translation-recoding [28], mRNA cleavage [29, 30, 31] or feedback-transcriptional control [32, 33]. It will be interesting to find the relative contribution of these different molecular processes to the degeneracy lifting uncovered here⁴⁴4We measured the change in mRNA levels of different yfp variants in response to amino acid limitation. Changes in mRNA levels were correlated with corresponding changes in YFP synthesis rates upon amino acid limitation (Fig. S14), but were smaller than expected.. Here, we have investigated the effect of a specific environmental perturbation associated with amino acid limitation in the bacterium E. coli. However, this type of perturbation plays a crucial role in the lifecycle of other bacteria such as Myxococcus xanthus and Bacillus subtilis that undergo differentiation cued by amino acid limitation [34, 35]. Protein synthesis during such differentiation events might also be regulated by degeneracy lifting of the genetic code. Moreover, degeneracy lifting could be important during protein synthesis in eukaryotes, where clinically-important conditions such as neoplastic transformation and drug treatment are often accompanied by a reduction in amino acid supply [36, 37]. Therefore lifting the degeneracy of the genetic code might emerge as a general strategy for biological systems to expand their repertoire of responses to environmental perturbations.

{materials}

Summary of key methods are given below. Detailed methods for all experiments and analyses are included in the Appendix.

2.1 Bacterial strains

All strains used in this study were obtained from the E.coli Genetic Stock Center (CGSC), Yale University. Different auxotrophic strains were used depending on the amino acid that was limiting in the growth medium (Table S5). Strains were stored as 20% glycerol stocks at -80^∘C either in 1ml cryo-vials or in 96-well plates (3799, Costar). For experiments involving over 25 strains, a temporary 20% glycerol stock was stored at -20^∘C in 96-well PCR plates.

2.2 Plasmids

The pZ series of plasmids [49] were used for expression of all genes constructed for this study. General features of the plasmid backbones are described here. Details on individual gene constructs that were inserted into these plasmid backbones, including DNA sequences and plasmid maps, are in Appendix. A low-copy plasmid, pZS*11 [SC101* ori (3-4 copies/cell), AmpR (bla gene) and a constitutive P ${}_{\textrm{L}}$ tetO1 promoter] was used for expression of all fluorescent reporter genes and their fusions. The synthetic ribosome binding site (RBS) in the original pZS*11 backbone was replaced by a modified T7-based RBS that resulted in efficient expression of most coding sequences. A medium-copy plasmid, pZA32 [p15A ori (10-12 copies/cell), ChlR (cat gene) and P ${}_{\textrm{L}}$ lacO1 promoter] was used for expression of all tRNA genes. Strains with pZA32 plasmids were grown with 1mM IPTG to ensure constitutive expression of all tRNA genes. Standard plasmids pUC18 and pUC19 were used as intermediate cloning vectors for site-directed mutagenesis.

2.3 Gene synthesis and cloning

A single yfp sequence was built de novo (synthesis by Genscript, USA). All subsequent yfp variants were constructed using a site-directed mutagenesis kit (Stratagene). tRNA genes and E. coli ORFs were amplified from the chromosome of a wild-type E. coli strain (MG1655) by PCR (Details on cloning and genes sequences in Appendix).

2.4 Amino acid limitation experiments

Overnight cultures were inoculated from glycerol stocks or fresh colonies and grown in a MOPS-based rich-defined medium with 800 $\mu M$ of 19 amino acids and 10mM serine at 30^∘C with shaking. For experiments involving amino acid limitation, overnight cultures were diluted 1:1000 into a similar rich-defined medium as the overnight cultures. However the amino acid, whose limitation was to be induced, was added at a reduced concentration and supplemented with its methyl-ester analog (see Table S6 for exact concentrations). Amino acid methyl-esters are inefficiently metabolized analogs of the corresponding amino acids and have been previously used for steady growth of E. coli under amino acid limiting conditions [51, 52] (see Figs. S15 and S16 for the effect of methyl-ester on growth and measured robustness during amino acid limited growth). Slight variations in the initial concentration of either the limiting amino acid or its methyl-ester only results in shifting of the transition to a higher or lower cell density without appreciable changes in growth rate (see Notes S1 and S2). Growth and fluorescence were quantified using a standard 96-well plate reader integrated with a robotic system. Further details on growth protocols are given in Appendix.

2.5 Analysis of cell density and fluorescence time series

Matlab R2009 (Mathworks) was used for all analyses unless otherwise mentioned. All correlations and P-values reported in this work were calculated using the Matlab command ‘corr’ with the ‘Type’ option set to either ‘Spearman’ or ‘Pearson’ as appropriate. Growth and fluorescence time series were fit with exponential and linear curves in the amino acid rich and amino acid limited growth regimes, respectively, and the onset time of amino acid limited growth was automatically inferred from their intersection. Protein synthesis rate, $S$ was calculated as:

\displaystyle\text{Protein synthesis rate }S=\frac{1}{\text{Absorbance}}\times\frac{d(\text{Fluorescence})}{d(\text{time})}

(1)

First, the above formula was evaluated at the onset time of amino acid limited growth using the exponential fits for absorbance and fluorescence data in the amino acid rich growth regime. Next, the same formula was evaluated at the onset time using the linear fits for absorbance and fluorescence data in the amino acid limited growth regime. These two values correspond to the protein synthesis rates reported for the amino acid rich and amino acid limited growth regimes (such as the data in Fig. 1D). Further details of this analysis are given in Appendix.

2.6 Calculation of CRI

CRI for a protein coding sequence corresponding to a limiting amino acid was calculated by multiplying the wi values for codons cognate to the limiting amino acid in that sequence. $w_{i}$ values shown in Fig. 3B were calculated using the robustness of protein synthesis of the corresponding yfp variants during cognate amino acid limitation (Fig. 1D). Based on our non-cognate limitation experiment (Fig. S2), the $w_{i}$ values for all codons other than those cognate to the limiting amino acid are set to be equal to 1. For illustration, we demonstrate the calculation of $w_{i}$ for the six leucine codons below. The exact same procedure was followed for other synonymous codon families. Taking log ${}_{\textrm{2}}$ $w_{i}\equiv W_{i}$ for each codon, and log ${}_{\textrm{2}}$ (robustness during amino acid limited growth) $\equiv SR$ for each yfp variant,

$\displaystyle 7\times W_{CTA}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,CTA}$	(2)
$\displaystyle 7\times W_{CTC}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,CTC}$	(3)
$\displaystyle 22\times W_{CTG}$	$\displaystyle=SR_{yfp,CTG}$	(4)
$\displaystyle 7\times W_{CTT}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,CTT}$	(5)
$\displaystyle 7\times W_{TTA}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,TTA}$	(6)
$\displaystyle 7\times W_{TTG}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,TTG}$	(7)

The multiplicative factors on the LHS in front of $W_{i}$ correspond to the frequency of the Leu codon $i$ in the corresponding Leu variant of yfp (see Fig. 1A). The RHS is the measured (log ${}_{\textrm{2}}$ ) robustness of protein synthesis from the corresponding yfp variant during Leu limitation (see Fig. 1D). These equations were solved simultaneously to determine the $w_{i}$ value for each Leu codon. Revised $w_{i}$ values based on yfp measurements in the presence of ${}^{\textrm{GAG}}$ Leu2 tRNA (Fig. 2) were used for calculation of Leu CRI in the case of GAGLeu2 tRNA co-expression with E. coli ORFs (Fig. 3D).

Acknowledgements.

We acknowledge J. Shapiro for work on developing the preliminary growth assays, and J. Gallant and M. Cashel for useful correspondence on optimizing the growth assays. A.S. is grateful to C. C. Guet for help with cloning and suggesting the tRNA co-expression experiments, and J. Moffitt for pointing him to the CP78 E. coli strain. We thank B. Stern, A. Murray, and V. Denic for critical questions. We thank K. Dave for editorial advice and assistance, and the members of the Cluzel lab and FAS Center for Systems Biology for experimental support. We acknowledge M. Aldana, L. David, D. A. Drummond, J. Elf, M. Kim, L. Marshall, M. Mueller, E. O’Shea, E. Wallace, J. Weissman, K. Wood, and B. Zid for comments on earlier versions of the manuscript. We are grateful to the anonymous referees for critical comments on the tRNA co-expression experiment.

References

[1] Shankar, R. (1994) Principles of quantum mechanics. (Plenum Press, New York), 2nd edition.
[2] Edelman, G. M & Gally, J. A. (2001) PNAS 98, 13763–13768.
[3] Baer, M & Billing, G. D. (2002) The role of degenerate states in chemistry, Advances in chemical physics ; v. 124. (J. Wiley & Sons, Hoboken, N.J.).
[4] Cowan, R. D. (1981) The theory of atomic structure and spectra, Los Alamos series in basic and applied sciences. (University of California Press, Berkeley).
[5] Affleck, I & Ludwig, A. W. W. (1991) Phys. Rev. Lett. 67, 161–164.
[6] Crick, F. (1955) On degenerate templates and the adaptor hypothesis: A note for the RNA tie club, Technical report.
[7] Reichmann, M. E, Rees, M. W, Symons, R. H, & Markham, R. (1962) Nature 195, 999–1000.
[8] Stelling, J, Sauer, U, Szallasi, Z, Doyle III, F. J, & Doyle, J. (2004) Cell 118, 675–685.
[9] Elf, J, Nilsson, D, Tenson, T, & Ehrenberg, M. (2003) Science 300, 1718–1722.
[10] Dittmar, K. A, Sorensen, M. A, Elf, J, Ehrenberg, M, & Pan, T. (2005) EMBO Rep 6, 151–157.
[11] Li, G.-W, Oh, E, & Weissman, J. S. (2012) Nature 484, 538–541.
[12] Robinson, M, Lilley, R, Little, S, Emtage, J. S, Yarranton, G, Stephens, P, Millican, A, Eaton, M, & Humphreys, G. (1984) Nucleic Acids Res. 12, 6663–6671.
[13] Gustafsson, C, Govindarajan, S, & Minshull, J. (2004) Trends Biotechnol. 22, 346–353.
[14] Krüger, M. K & Sørensen, M. A. (1998) J. Mol. Biol. 284, 609–620.
[15] Sørensen, M. A. (2001) J. Mol. Biol. 307, 785–798.
[16] Sørensen, M. A, Elf, J, Bouakaz, E, Tenson, T, Sanyal, S, Björk, G. R, & Ehrenberg, M. (2005) J Mol Biol 354, 16–24.
[17] Ibba, M, Söll, & Dieter. (1999) Science 286, 1893–1897.
[18] Sharp, P. M & Li, W. H. (1987) Nucleic Acids Res. 15, 1281–1295.
[19] dos Reis, M, Savva, R, & Wernisch, L. (2004) Nucleic Acids Res 32, 5036–5044.
[20] Kudla, G, Murray, A. W, Tollervey, D, & Plotkin, J. B. (2009) Science 324, 255–258.
[21] Gershenfeld, N. A & Chuang, I. L. (1997) Science 275, 350–356.
[22] Chuang, I. L, Vandersypen, L. M. K, Zhou, X, Leung, D. W, & Lloyd, S. (1998) Nature 393, 143–146.
[23] Lind, P. A, Berg, O. G, & Andersson, D. I. (2010) Science 330, 825–827.
[24] Traxler, M. F, Summers, S. M, Nguyen, H.-T, Zacharia, V. M, Hightower, G. A, Smith, J. T, & Conway, T. (2008) Mol Microbiol 68, 1128–1148.
[25] Durfee, T, Hansen, A.-M, Zhi, H, Blattner, F. R, & Jin, D. J. (2008) J. Bacteriol. 190, 1084–1096.
[26] Kuroda, A, Nomura, K, Ohtomo, R, Kato, J, Ikeda, T, Takiguchi, N, Ohtake, H, & Kornberg, A. (2001) Science 293, 705–708.
[27] Tuller, T, Carmi, A, Vestsigian, K, Navon, S, Dorfan, Y, Zaborske, J, Pan, T, Dahan, O, Furman, I, & Pilpel, Y. (2010) Cell 141, 344–354.
[28] Zaher, H & Green, R. (2011) Cell 147, 396–408.
[29] Christensen, S. K & Gerdes, K. (2003) Mol. Microbiol. 48, 1389–1400.
[30] Li, X, Yagi, M, Morita, T, & Aiba, H. (2008) Mol Microbiol 68, 462–473.
[31] Garza-Sánchez, F, Gin, J. G, & Hayes, C. S. (2008) J Mol Biol 378, 505–519.
[32] Henkin, T. M & Yanofsky, C. (2002) BioEssays 24, 700–707.
[33] Proshkin, S, Rahmouni, A. R, Mironov, A, & Nudler, E. (2010) Science 328, 504–508.
[34] Dworkin, M. (1996) Microbiol Rev 60, 70–102.
[35] Ochi, K, Kandala, J. C, & Freese, E. (1981) J. Biol. Chem. 256, 6866–6875.
[36] Ye, J, Kumanova, M, Hart, L. S, Sloane, K, Zhang, H, Panis, D. N. D, Bobrovnikova-Marjon, E, Diehl, J. A, Ron, D, & Koumenis, C. (2010) EMBO J 29, 2082–2096.
[37] Zhou, Y, Goodenbour, J. M, Godley, L. A, Wickrema, A, & Pan, T. (2009) Biochem BioPhys Res Comm 385, 160–164.
[38] Lutz, R & Bujard, H. (1997) Nucleic Acids Res. 25, 1203–1210.
[39] Yelverton, E, Lindsley, D, Yamauchi, P, & Gallant, J. A. (1994) Mol. Microbiol. 11, 303–313.
[40] Gallant, J, Bonthuis, P, Lindsley, D, Cabellon, J, Gill, G, Heaton, K, Kelley-Clarke, B, MacDonald, L, Mercer, S, Vu, H, & Worsley, A. (2004) J. Mol. Biol. 342, 713–724.
[41] Andersson, S. G & Kurland, C. G. (1990) Microbiol Rev 54, 198–210.
[42] Fiil, N & Friesen, J. D. (1968) J Bacteriol 95, 729–731.
[43] Ikemura, T & Dahlberg, J. E. (1973) J. Biol. Chem. 248, 5033–5041.
[44] Laffler, T & Gallant, J. (1974) Cell 1, 27–30.
[45] Ninnemann, O, Koch, C, & Kahmann, R. (1992) EMBO J. 11, 1075–1083.
[46] Baba, T, Ara, T, Hasegawa, M, Takai, Y, Okumura, Y, Baba, M, Datsenko, K. A, Tomita, M, Wanner, B. L, & Mori, H. (2006) 2.
[47] Datsenko, K. A & Wanner, B. L. (2000) Proc. Natl. Acad. Sci. U.S.A. 97, 6640–6645.
[48] Datta, S, Costantino, N, & Court, D. L. (2006) Gene 379, 109–115.
[49] Lutz, R & Bujard, H. (1997) Nucleic Acids Res. 25, 1203–1210.
[50] Wanner, B. L, Kodaira, R, & Neidhardt, F. C. (1977) J. Bacteriol. 130, 212–222.
[51] Yelverton, E, Lindsley, D, Yamauchi, P, & Gallant, J. A. (1994) Mol. Microbiol. 11, 303–313.
[52] Gallant, J, Bonthuis, P, Lindsley, D, Cabellon, J, Gill, G, Heaton, K, Kelley-Clarke, B, MacDonald, L, Mercer, S, Vu, H, & Worsley, A. (2004) J. Mol. Biol. 342, 713–724.
[53] Nagai, T, Ibata, K, Park, E. S, Kubota, M, Mikoshiba, K, & Miyawaki, A. (2002) Nat. Biotechnol. 20, 87–90.
[54] Dong, H, Nilsson, L, & Kurland, C. G. (1996) Journal of Molecular Biology 260, 649–663.
[55] Tuller, T, Waldman, Y. Y, Kupiec, M, & Ruppin, E. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 3645–3650.
[56] Navon, S & Pilpel, Y. (2011) Genome Biol. 12, R12.
[57] Reis, M. d, Savva, R, & Wernisch, L. (2004) Nucleic Acids Res 32, 5036–5044.
[58] Markham, N. R & Zuker, M. (2008) Methods Mol. Biol. 453, 3–31.
[59] Traxler, M. F, Zacharia, V. M, Marquardt, S, Summers, S. M, Nguyen, H.-T, Stark, S. E, & Conway, T. (2011) Mol. Microbiol. 79, 830–845.
[60] Li, G.-W, Oh, E, & Weissman, J. S. (2012) 484, 538–541.
[61] Björk, G. R. (1996) in Escherichia coli and Salmonella : cellular and molecular biology. (ASM Press, Washington, D.C.), 2nd edition.

Refer to caption — Figure 1: Degeneracy lifting associated with amino acid limitation.

{article}

3 Appendix

4 Bacterial strains

All strains used in this study were obtained from the E.coli Genetic Stock Center (CGSC), Yale University. For amino acid limitation experiments, standard auxotrophic strains (Table LABEL:listofstrains) were used depending on the amino acid that was limiting in the growth medium, unless mentioned otherwise. Strain CP78 was used for experiments involving leucine and arginine limitation. This strain has been used extensively in previous amino acid limitation studies [42, 43, 44, 45, 15, 10] and its multiple auxotrophy makes it a convenient choice for experiments involving limitation for several amino acids. The auxotrophic strains corresponding to the remaining amino acids are from the Keio-knockout collection [46], and are the commonly used auxotrophic strains for that amino acid (http://cgsc.biology.yale.edu/Auxotrophs.php).

For the growth lag measurements in Fig. 4A, the prototrophic strain MG1655 (Table LABEL:listofstrains) was used as the wild-type background. This background strain was tagged with yfp or rfp at the attB $\lambda$ locus (this tagging was a remnant from earlier experiments not related to this work, and has no relevance to any results presented here). Site-directed mutagenesis was used to create the synonymous mutant coding sequences for leuA, leuC, leuD, carA, argA and argF using the protocol described in the section on gene synthesis and cloning. Then to insert these mutant ORFs into their native locus without any additional markers, a two-step strategy based on $\lambda$ Red-mediated homologous recombination [47] was used: In the first step, the respective wild-type ORF was replaced by a kan resistance gene, and in the second step the kan gene was replaced by the mutant ORF without any additional markers by selecting on M9-glucose plates for prototrophy of the respective amino acid. Plasmid pSIM5 [48] was used as the helper plasmid and a previously published recombineering protocol [48] was used without any modifications.

For RT-qPCR (Fig. 4B), a leucine auxotroph of MG1655 was created by deleting the leuB gene using the $\lambda$ Red-mediated homologous recombination protocol outlined above. For Western blots (Fig. S1), the auxotrophic strains in Table LABEL:listofstrains were further modified by insertion of the tet repressor gene at the $attB\lambda$ site using a previous method based on $\lambda$ integrase-mediated site-specific recombination [49]. The presence of Tet repressor enabled inducible control of YFP expression. The Western blots for leucine and arginine yfp variants were performed in an MG1655 auxotroph strain background instead of the CP78 strain. The CP78 strain has lower transformation efficiency which prevented integration of the tet repressor gene into the chromosome. Strains were stored as 20% glycerol stocks at -80^∘C either in 1ml cryo-vials or in 96-well plates (3799, Costar). In addition, for experiments involving over 25 strains, a temporary 20% glycerol stock was stored at -20^∘C in 96-well PCR plates.

5 Plasmids

The pZ series of plasmids [49] were used for extra-chromosomal expression of genes. General features of the plasmid backbones are described here. Specific gene constructs that were cloned into these backbones is described in the section on gene synthesis and cloning. A low-copy plasmid, pZS*11 [SC101* ori (3-4 copies/cell), AmpR (bla gene) and a constitutive $P_{L}$ tetO1 promoter] was used for expression of all fluorescent reporter genes and their fusions. The synthetic ribosome binding site (RBS) in the original pZS*11 backbone was replaced by a modified T7-based RBS that resulted in efficient protein expression from most coding sequences. A medium-copy plasmid, pZA32 [p15A ori (10-12 copies/cell), ChlR (cat gene) and $P_{L}$ lacO1 promoter] was used for expression of all tRNA genes. Strains with pZA32 plasmids were grown with 1mM IPTG to ensure constitutive expression of all tRNA genes. Standard plasmids pUC18 and pUC19 (Invitrogen) were used as intermediate cloning vectors for site-directed mutagenesis. Plasmid pSIM5 (13) was used as the helper plasmid expressing the $\lambda$ -Red system for all chromosomal modifications in this project (except for Tet repressor insertion mentioned in the previous section).

6 Growth and fluorescence measurements

Overnight cultures were inoculated either from freshly grown single colonies or, in experiments involving more than 25 strains, from temporary glycerol stocks stored at -20C. Overnight cultures were grown in a modified MOPS rich-defined medium [50] made with the following recipe: 10X MOPS rich buffer, 10X ACGU nucleobase stock and 100X 0.132M K2HPO4 (Teknova, Cat. No. M2105) were used at 1X final concentration as in the original recipe. In addition, the overnight growth medium contained 0.5% glucose as carbon source, $10^{-4}$ % thiamine and 800 $\mu$ M of 19 amino acids and 10mM of serine. pH was adjusted to 7.4 using 1M NaOH and appropriate selective antibiotics (50 $\mu$ g/ml ampicillin and/or 20 $\mu$ g/ml chloramphenicol) were added. Amino acids, glucose, thiamine and antibiotics were purchased from Sigma. 1ml overnight cultures were grown in 2ml deep 96-well plates (40002-014, VWR) at 30^∘C with shaking at 1350rpm (Titramax 100 shaker) for 12 to 16 hours.

For amino acid limitation experiments, overnight cultures were diluted 1:1000 into 1ml of the same MOPS rich-defined medium as the overnight cultures. However the amino acid whose limitation was to be induced was added at a reduced concentration and supplemented with its methyl ester analog (Table LABEL:aaconcntable). Amino acid methyl esters are analogs of the corresponding amino acids and have been previously used for steady growth of E. coli under amino acid limiting conditions [51, 52] (see Figs. S15 and S16 for the effect of methyl ester on growth and robustness of YFP synthesis). Addition of the methyl esters results in a steady but limiting supply of the amino acid due to slow hydrolysis of the ester (see Note 1). Concentrations of the amino acid and its methyl ester were chosen such that the cultures consumed the limiting amino acid and entered amino acid-limited growth at an $OD_{600}$ of 0.6-0.7 (corresponding to an $OD_{600}$ value of 0.2-0.25 in our 96-well plate reader). Slight variations in the initial concentration of either the limiting amino acid or its methyl ester shift the transition to a higher or lower cell density without appreciable changes in growth rate (see Note 2). Except for a single limiting amino acid, the remaining 19 amino acids were present at the overnight culture concentrations during the amino acid limitation experiments. For proline limitation, no proline was necessary in the growth medium since proline methyl ester supported growth at the same rate as proline until the $OD_{600}$ reached around 0.6.

Diluted overnight cultures were grown in 2ml deep 96-well plates for 3 hours at 30^∘C with shaking at 1350rpm (Titramax 100 shaker). After this time interval, 3 aliquots of 150 $\mu$ l from each culture was pipetted into 3 wells of 3 different 96-well plates (3799, Costar). Wallac Victor2 plate reader (PerkinElmer) was used to monitor cell density (absorbance at 600nm) and YFP synthesis (fluorescence, excitation 504nm and emission 540nm). Each plate was read every 15 min using a robotic system (Caliper Life Sciences) and shaken in between readings (Variomag Teleshake shaker) for a total period of 6-10 hours. Temperature of 30^∘C and relative humidity of 60% was maintained throughout the experiment.

In the case of experiments without methyl ester (Figs. S15 and S16), the same protocol mentioned above was followed but the methyl esters were not added to the growth medium. For the RT-qPCR measurements shown in Fig. 4B, overnights cultures were diluted 1:1000 into the same medium. Then when the $OD_{600}$ reached 0.5, the cells were spun down at 3000g for 5 min and then re-suspended in the same medium but either with or without leucine. Total RNA was extracted (see protocol below) after 30 min of shaking at 30^∘C, 200rpm.

For the growth lag measurements shown in Fig. 4A, overnight cultures of prototrophic strains were diluted 1:200 into medium either with or without one of leucine and arginine. Growth lag was measured as the difference in time taken to reach $OD_{600}$ of 0.3 between two cultures of the same strain – one growing in the presence of either leucine or arginine and another growing in its absence.

7 Gene synthesis and cloning

All gene sequences constructed for this study are provided in the gene_sequences.fasta file. Plasmid backbone sequences are provided in the plasmid_sequences.genbank file. Primer sequences used for cloning will be provided upon request. For all primers, 18 to 22bp homologies without any special primer design criteria were sufficient for successful PCR amplification with Phusion High-Fidelity DNA polymerase (NEB).

7.1 Initial yfp construct

All yfp variants used in this study were modified starting from a single yellow fluorescent protein gene sequence (called yfp0 in the sequence file and plasmid map). This yfp0 sequence encoded the fast-maturing ‘Venus’ variant of YFP [53]. All 238 codons of yfp0 were chosen such that they were decoded by abundant tRNA isoacceptors for each amino acid. Such a choice of codons ensured that the native level of demand for each tRNA isoacceptor inside the cell was minimally perturbed by the low-copy expression of fluorescent reporter genes. The yfp0 sequence was built de novo (synthesis by Genscript, USA). The synthesized yfp0 sequence was cloned between the KpnI and HindIII restriction sites of the pZS*11 plasmid vector using standard molecular-biology techniques (19). The plasmid map of the resulting construct, pZS*11-yfp0 is shown in Fig. S17.

7.2 Synonymous variants of yfp

A subset of codons in yfp0 corresponding to 7 amino acids (Leu, Arg, Ser, Pro, Ile, Gln, Phe) were mutated to create the initial 29 synonymous variants of yfp (yfp1 – yfp29 in the gene_sequences.fasta file, sequences in the same order as shown in Fig. 1A). The 4 yfp variants corresponding to Pro (yfp19-yfp22) had all the Pro codons mutated to the most frequent CCG codon since the original yfp0 sequence had a few CCA and CCT codons that are more sensitive to Pro limitation. Similarly, all the Phe codons in yfp0 were mutated to the most abundant Phe codon TTT for the two Phe variants of yfp0 (yfp28-yfp29). Both these groups of variants (6 total) had higher overall fluorescence during amino-acid rich conditions than the rest of the 23 variants. This higher fluorescence is likely due to changes in secondary structure near the ribosome binding region on the mRNA as a consequence of mutations near ATG. However, this change is common across all variants within the Pro and Phe synonymous codon groups and hence is not responsible for the differential response to cognate amino acid limitation measured within these synonymous codon groups.

For constructing the 29 yfp variants, yfp0 from pZS*11-yfp0 was first cloned into a pUC19 cloning vector between the KpnI and HindIII restriction sites. A commercial site-directed mutagenesis kit (Quickchange Lightening Multi, Applied Biosystems) was used to introduce the mutations corresponding to each of the 29 variants and the manufacturer’s protocol was followed. The resulting variants were verified by Sanger sequencing and then cloned into the pZS*11 expression vector backbone between the KpnI and HindIII sites. The 22 single CTA variants of yfp (Fig. S2) were constructed using the same procedure as above. The 29 yfp variants for Western blotting (Fig. S1) were created using the same procedure as above, but with the addition of a 22 codon sequence at the 5^′ end that encoded a 3X-FLAG peptide recognized by a commercially available, anti-FLAG, antibody (Sigma). The 22-codon sequence is: GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAG.

7.3 tRNA expression vectors

The 5 distinct Leu tRNA isoacceptors encoded by the genes leuQ, leuU, leuW, leuX and leuZ, and the 4 distinct Arg tRNA isoacceptors encoded by the genes argV, argX, argU and argW were cloned between the EcoRI and HindIII sites of the pZA32 expression vector (Fig. S18). These genes were amplified by PCR from the chromosome of E. coli strain MG1655. In addition to these native tRNA genes, a synthetic tRNA gene arg2_m cognate to the CGA Arg codon was also created. Normally, the ${}^{\textrm{ACG}}$ Arg2 tRNA with ICG anti-codon reads the CGA codon inefficiently through a purine-purine wobble pairing. Expressing a synthetic tRNA with an anticodon UCG restores efficient reading of this codon and is equivalent to increasing the supply of the corresponding cognate tRNA isoacceptor. This synthetic tRNA isoacceptor was created from the pZA32-argV expression vector using overlap PCR to introduce the necessary single bp mutation in the anticodon of argV. The pZA32 vectors with the tRNA genes were electroporated into strains already containing the YFP expression vectors.

7.4 Library of E. coli ORF-yfp fusions

92 E. coli Open Reading Frames (ORFs) were selected for experimental validation of the Leu Codon Robustness Index (Leu CRI). These ORFs were chosen to span a wide range of predicted Leu CRI values and functional categories (Fig. S7 and Table LABEL:92orfs). First, a modified pZS*11-yfp0 vector backbone was created in which the start codon of yfp0 was replaced by a GGSGGS hexa-peptide linker sequence: GGTGGATCCGGCGGTTCT containing a BamHI restriction site. Next, the 92 ORFs (without the stop codon) were amplified by PCR from the chromosome of E. coli strain MG1655 with 5^′-KpnI and 3^′-BamHI restriction site overhangs. These PCR fragments were cloned into the modified pZS*11-yfp0 vector backbone containing the BamHI restriction site. 13 of the 92 ORFs had either an internal KpnI or an internal BamHI site. In these cases, a larger fragment that included adjoining sections of the pZS*11-yfp0 vector was constructed by overlap PCR and then cloned using other restriction sites (EcoRI or HindIII). Thus the final constructs had one of the 92 E. coli ORFs connected through a hexapeptide linker with yfp0. All the cloned sequences were verified by PCR for inserts of right length and around 40 ORF constructs were verified by Sanger sequencing. Two biological replicates of each ORF construct were compared for their synthesis robustness values as measured during the amino acid limitation assay and these values showed a high degree of correlation (Pearson $\rho$ = 0.93, Fig. S19).

For validating the Arg codon robustness index (Arg CRI), 56 E. coli ORFs that included a subset of the above 92 ORFs were chosen (Table LABEL:56orfs). The cloning procedure was exactly analogous to the above 92 ORFs but with one difference: the yfp0 part of the fusion construct was replaced by a synonymous variant of yfp0 (yfp7) that had the Arg codon AGA instead of the CGT and CGC codons in the yfp0 sequence. The codon AGA has the highest $w_{i}$ value among the Arg codons (see Fig. 3B) and hence has a minimal effect on the measured robustness of the ORF fusions during Arg limitation.

7.5 Co-expression of ${}^{\textrm{GAG}}$ Leu2-tRNA with E. coli ORF-yfp fusions

Out of the 92 E. coli ORF-yfp fusions, 21 were chosen for co-expression with the ${}^{\textrm{GAG}}$ Leu2 tRNA that is cognate to the codons CTC and CTT. The 21 ORFs were chosen such that 11 of them had a lower Leu CRI prediction than their wild-type counterparts while the other 10 ORFs had a higher Leu CRI prediction than their wild-type counterparts (Table LABEL:21orfs). This choice also corresponded respectively to either high frequency of the non-cognate TTA and TTG codons for ${}^{\textrm{GAG}}$ Leu2 or high frequency of the cognate codons CTC and CTT. The strains containing the 21 ORF fusions were each made electro-competent and then transformed with the pZA32-leuU plasmid that expresses ${}^{\textrm{GAG}}$ Leu2.

7.6 Synonymous variants of E. coli ORF-yfp fusions

Out of the 92 E. coli ORF-yfp fusions, 13 were selected for creating synonymous mutants (Table LABEL:56orfs). These 13 ORFs had a high frequency of one or both of the Leu codons, TTA or TTG and these codons were mutated to the Leu codon, CTC. All these 3 codons, TTA, TTG and CTC occur at similar frequencies on average across the genome of E. coli.The 13 ORF-yfp fusions were amplified by PCR from the pZS*11 vectors between the EcoRI and XbaI restriction sites (see Fig. S17). These fragments were cloned between EcoRI and XbaI sites of the pUC19 cloning vector. A commercial site-directed mutagenesis kit (Quickchange Lightening Multi, Applied Biosystems) was used to introduce the TTA, TTG $\rightarrow$ CTC mutations. A unique primer was designed for each of the TTG or TTA codons in the 13 ORFs, and these primers encoded the CTC mutation. All the primers corresponding to each ORF were mixed and then used in the mutagenesis reaction. This procedure resulted in mutant coding sequences with TTA, TTG $\rightarrow$ CTC mutations at random locations. 10 colonies for each ORF were sequenced and each unique mutant sequence was then cloned into the pZS*11 expression vector. At the end of the procedure, a total of 63 constructs were created that each had between one and seven TTA, TTG $\rightarrow$ CTC mutations (see gene_sequences.fasta file for exact sequences).

8 Total RNA extraction

Total RNA was extracted for two different experiments (Figs. 4B, S14). Phenol-chloroform extraction method was used to obtain total RNA. Briefly, 3ml of cells were quickly mixed with 5ml of ice-cold water and harvested by centrifugation at 3000g for 10min. Cell pellets were re-suspended in 500 $\mu$ l of 0.3M sodium acetate-10mM EDTA, pH 4.8 buffer. The re-suspended cells were mixed with 500 $\mu$ l of acetate-saturated phenol-chloroform at pH 4.8, 50 $\mu$ l of 20% SDS and 500 $\mu$ l of acid-washed glass beads (G1277, Sigma). The mixture was shaken in a vortexer for 20 min at 4C. The aqueous layer was extracted twice with acetate-saturated phenol-chloroform at pH 4.8 and once with chloroform. Total RNA was precipitated with an equal volume of isopropanol and washed with 70% ethanol-50mM sodium acetate pH 4.8 and finally re-suspended in 200 $\mu$ l of RNase-free water. 20 $\mu$ l of the total RNA was treated with DNase (EN0521, Fermentas) to remove residual DNA contamination (manufacturer’s instructions were followed). The DNA-free RNA was re-suspended in 200 $\mu$ l of RNase-free water. Intact RNA was confirmed by observation of sharp rRNA bands in native agarose gel electrophoresis.

9 RT-qPCR

Reverse transcription (RT) was performed using 4 $\mu$ l of the DNA-free RNA (100-200ng) and Maxima reverse transcription kit (K1641, Fermentas), used according to the manufacturer’s instructions. Random hexamer primers were used for priming the RT reaction. At the end of the RT reaction, the 20 $\mu$ l reaction was diluted 100-fold and 10 $\mu$ l of this diluted sample was used for qPCR in the next step. qPCR was performed using Maxima SYBR-Green qPCR kit (K0221, Fermentas) and manufacturer’s instructions were followed. qPCR was performed in triplicates for each RT reaction and appropriate negative RT controls were used to confirm the absence of DNA contamination. gapA mRNA was used as internal reference to normalize all other mRNA levels. Standard curves with 6 serial dilutions were used to optimize reaction conditions and ensure amplification efficiency of between 90-100% for the yfp and gapA amplicons. $\Delta\Delta C_{t}$ method was used to obtain the change in mRNA levels due to amino acid limitation. The qPCR primer sequences are given in Table LABEL:qPCRprimersequences.

10 Western blotting

Fresh colonies were used to inoculate overnight cultures. These overnight cultures were then diluted 1:100 into 1ml of rich-defined medium with all 20 amino acids (see section on growth and fluorescence measurements for media composition). After approximately 3.5 hours of growth at 30^∘C when $OD_{600}$ was $\sim$ 0.4, cells were spun down at 9000g for 1 min, and then re-suspended in 1ml of rich-defined medium without the amino acid whose limitation was to be induced. This re-suspended culture was then split into two equal aliquots. The limiting amino acid was added to one aliquot (as a rich-medium control) while the other aliquot did not have the limiting amino acid. The re-suspended medium also contained 200ng/ml of anhydro-tetracycline in order to induce the $p_{L}$ tetO1 promoter that controls the 3XFLAG-yfp variants. After growth at 30^∘C for 60 min, cells were spun down at 12000g, 1 min and re-suspended in 40-400 $\mu$ l of CellLytic B buffer (Sigma, B7435). The buffer volume used was proportional to the $OD_{600}$ measured at the time of harvesting the culture. The lysate was stored at -80^∘C. 10 $\mu$ l of the lysate was mixed with 2X Laemmli Buffer (Biorad) and then loaded onto each lane of a pre-cast polyacrylamide gel (Biorad) and SDS-PAGE was carried out at 100V for 120 min. Proteins were transferred to a nitrocellulose membrane by semi-dry blotting at 180mA for 60 min. The membrane was blocked in 2% skim-milk-TBST overnight, and then incubated with a 1:2000 dilution of an anti-FLAG antibody (F3165, Sigma) in 10ml of 2% skim-milk-TBST with shaking at room temperature for 90 min. After washing 4 times for 5 min with TBST, the membrane was incubated with 1:2000 dilution of a secondary HRP-conjugated antibody (7076, Cell Signaling) in 15ml of 2% skim-milk-TBST with shaking at room temperature for 60 min. After washing 4 times for 5 min with TBST, the membrane was treated with an HRP substrate (L00354, Genscript) for 5 min and exposed for 30s to a luminescence imager.

11 Analyses

Matlab R2009b (Mathworks) was used for all analyses unless otherwise mentioned. All correlations and P-values reported in this work were calculated using the Matlab command ‘corr’ with the ‘Type’ option set to either ‘Spearman’ or ‘Pearson’ as appropriate.

11.1 Growth and fluorescence analysis

Background absorbance and fluorescence values (obtained from wells containing only growth media) were subtracted from the measured time series for each well. An exponential curve was fitted to the amino acid-rich growth regime for all data points located at least 50 min before the onset of amino acid limitation. A straight line was fitted to the amino acid-limited growth regime for all data points located at least 50 min after the onset time. These fits were performed using the Matlab command ‘fit’, and the in-built library options ‘Exp1’ and ‘Poly1’ respectively. To automatically identify the onset time, the intersection point between the two fitted curves was designated as the onset time of amino acid limitation. This inferred onset time coincided with the onset time identified through visual inspection of the growth curves.

To minimize noise in calculated protein synthesis rates, an exponential curve was fitted to the amino acid-rich regime of the fluorescence time-series and a straight line was fitted to the amino acid-limited regime of the fluorescence time-series. These fits were performed using the Matlab command fit, and the in-built library options ‘Exp1’ and ‘Poly1’ respectively. Protein synthesis rate, $S$ was calculated as

\displaystyle\text{Protein synthesis rate }S=\frac{1}{\text{Absorbance}}\times\frac{d(\text{Fluorescence})}{d(\text{time})}

(8)

First, the above formula was evaluated at the onset time of amino acid limitation using the exponential fits for absorbance and fluorescence data in the amino acid rich growth regime. Next, the same formula was evaluated at the onset time using the linear fits for absorbance and fluorescence data in the amino acid limited growth regime. These two values correspond to the protein synthesis rates reported for the amino acid rich and amino acid limited growth regimes (such as the data in Fig. 1D). The protein synthesis rates were normalized within each synonymous codon family and for each growth condition. Robustness of protein synthesis to amino acid limitation was calculated as the ratio of normalized protein synthesis rates between the amino acid rich and amino acid limited growth regimes.

In the case of the experiment without methyl ester (Fig. S15 and Fig. S16), the onset time of amino acid limited growth was determined exactly as above. Then starvation robustness was calculated as the normalized ratio of total fluorescence increase after the onset of amino acid limited growth to the fluorescence increase before this onset. Total fluorescence increase rather than protein synthesis rate was used for this analysis since protein synthesis rates decreased continuously to zero after the onset of amino acid limited growth in the absence of methyl ester analogs.

11.2 Calculation of CRI

CRI for a protein coding sequence corresponding to a limiting amino acid was calculated by multiplying the $w_{i}$ values for codons cognate to the limiting amino acid in that sequence. $w_{i}$ values in Fig. 3B were calculated using the robustness of protein synthesis of the corresponding yfp variants during cognate amino acid limitation (Fig. 1D). Based on the non-cognate amino acid limitation experiment (Fig. S2), the $w_{i}$ values for all codons other than those cognate to the limiting amino acid are set to be equal to 1. For illustration, we demonstrate the calculation of $w_{i}$ for the six Leu codons below. The exact same procedure was followed for other synonymous codon families. Taking $log_{2}w_{i}\equiv W_{i}$ for each codon, and $log_{2}(\text{robustness during amino acid limited growth})\equiv SR$ for each yfp variant,

$\displaystyle 7\times W_{CTA}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,CTA}$	(9)
$\displaystyle 7\times W_{CTC}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,CTC}$	(10)
$\displaystyle 22\times W_{CTG}$	$\displaystyle=SR_{yfp,CTG}$	(11)
$\displaystyle 7\times W_{CTT}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,CTT}$	(12)
$\displaystyle 7\times W_{TTA}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,TTA}$	(13)
$\displaystyle 7\times W_{TTG}+15\times W_{CTG}$	$\displaystyle=SR_{yfp,TTG}$	(14)

The multiplicative factors on the LHS in front of $W_{i}$ correspond to the frequency of the Leu codon $i$ in the corresponding Leu variant of yfp (see Fig. 1A). The RHS is the measured (log2) robustness of protein synthesis from the corresponding yfp variant during Leu limitation (see Fig. 1D). These equations were solved simultaneously to determine the $w_{i}$ value for each Leu codon. Revised $w_{i}$ values (Table LABEL:wi_values_for_tRNA_coexpression) based on yfp measurements in the presence of ${}^{\textrm{GAG}}$ Leu2 tRNA (Fig. 2) were used for calculation of Leu CRI in the case of ${}^{\textrm{GAG}}$ Leu2 tRNA co-expression with E. coli ORFs (Fig. 3D).

11.3 Leu and Arg CRI for E. coli ORFs

4300 E. coli ORF sequences were parsed out from the MG1655 genome sequence (NCBI website, Accession number: NC_000913, downloaded on 14th Apr 2011). For each of these 4300 E. coli ORFs, Leu or Arg CRI was calculated by multiplying the $w_{i}$ values for either all Leu or all Arg codons respectively in the ORF sequence. For the 63 synonymous variants of 13 ORFs (Fig. S10), Leu CRI values were calculated using the same procedure as above after accounting for the synonymous mutations. For the 21 ORFs co-expressed with Leu2 tRNA (Fig. 3D), revised $w_{i}$ values were first calculated using the method outlined in the previous section (Table LABEL:wi_values_for_tRNA_coexpression), and using measurements on the 6 Leu variants of yfp complemented with ${}^{\textrm{GAG}}$ Leu2 tRNA (3rd column in Fig. 2A). These revised $w_{i}$ values were then used to calculate Leu CRI under tRNA co-expression for the 21 tRNA co-expressed ORFs applying the same procedure as for the non co-expressed case.

11.4 Z-score for CRI

To quantify the deviation in CRI from its expected value for each of the 4300 ORFs in the E. coli genome, 1000 random coding sequences were generated for each ORF. Each random version preserved the original amino acid sequence, but the codons for a single amino acid were sampled randomly from a multinomial distribution based on the average frequency of codons for that amino acid in the genome. CRI values were calculated for each random version of the gene, and a distribution of CRI values was generated from the 1000 random trials. The average, $\mu_{CRI}$ and standard deviation, $\sigma_{CRI}$ of this CRI distribution was used to calculate the Z-score for CRI as follows:

\displaystyle Z_{CRI}=\frac{CRI_{observed}-\mu_{CRI}}{\sigma_{CRI}}

(15)

In the case of the Z-score for leucine shown in Fig. 4B, the leucine codon CTG was not randomized in the above calculation and only the remaining 5 leucine codons: CTA, CTC, CTT, TTA, and TTG were randomized. This step is important since CTG, which is read by an abundant tRNA isoacceptor, is enriched in highly-expressed genes, and such genes will show up falsely as perturbation-robust genes because CTG is also the codon that is most robust to leucine limitation in our experiments (see Fig. 1D).

11.5 Codon-specific bioinformatic measures

Codon usage in Fig. S4 was calculated as the average frequency of each codon across the genome of E. coli MG1655 (4300 ORFs). tRNA concentrations in Fig. S4 were taken from previous work (see Table 2 in [54]). Concentrations of all cognate tRNAs for each codon were summed together. The codon-tRNA adaptation index in Fig. S4 is taken from literature (see Table S2 in [55]). The tAI value for the CGA codon was revised from the unrealistically low value of 0.00005 to 0.1333 as explained previously [56]. For inferring codon elongation rates from charged tRNA fractions (Fig. S5), we used the formula for codon elongation rate from [9]:

\displaystyle\frac{1}{v_{k}}=\tau_{0}+\frac{1}{\Sigma_{i}t_{i}\alpha_{i}k_{ik}},

(16)

where $v_{k}$ is the elongation rate of codon $k$ , $\tau_{0}$ is the codon-independent elongation time across any codon, $t_{i}$ is the concentration of tRNA isoacceptor $i$ that is cognate to codon $k$ , $k_{ik}$ is the second-order rate constant for binding of the ternary complex containing the charged isoacceptor $i$ to the ribosome at codon $k$ , and $\alpha_{i}$ is the charged fraction of isoacceptor $i$ . We calculated the codon elongation rates during amino acid limitation using the measured charged fractions from [10]. For amino acid rich conditions, we set the charged fraction to be equal to unity. We used $\tau_{0}=0.05s^{-1}$ , and $k_{ik}=2\times 10^{7}M^{-1}s^{-1}$ similar to [9]. The ratio of codon elongation rates was then normalized within each codon family by the maximum value within that family.

11.6 ORF-specific bioinformatic measures

Codon Adaptation Index was calculated for each E. coli ORF using the method in [18]. This calculation was implemented using the CodonAdaptationIndex class in the CodonUsage module of BioPython (version 1.58). tRNA Adaptation Index was calculated for each E. coli ORF using the method in [57]. This calculation was implemented using the codonR package ( http://people.cryst.bbk.ac.uk/~fdosr01/tAI/index.html, downloaded on 3rd Sep 2011). mRNA folding energy was calculated for the first 37nt of each E. coli ORF together with the 5 upstream nucleotides (GTACC) in the pZS11 plasmid backbone. Calculation was implemented using the hybrid-ss-min command in UNAFold software v3.8 [58] with default parameter values for reaction conditions (NA = RNA, T = 37, [Na+] = 1, [Mg++] = 0, maxloop = 30).

12 Supplementary notes

12.1 Use of methyl esters in amino acid limitation experiments

Before we settled on the methyl ester analog-based experiments, we tested two other amino acid limitation assays that are commonly used in the literature. The first assay is a spin $\rightarrow$ wash $\rightarrow$ resuspend in amino acid+ / amino acid– medium [10]. We did not pursue this assay for most experiments since it is logistically difficult to perform this assay when working simultaneously with more than a dozen strains. However, we used this assay for the Western blotting and RT-qPCR measurements on a few strains (Figs. S1, S14 and 4B).

The second assay involves starting with a low initial concentration of an amino acid and letting the bacterial cultures exhaust the amino acid in the medium through exponential growth [59]. The bacteria then enter the amino acid limited regime in mid-log phase without any intervention from the experimenter. However in the absence of exogenous sources of amino acid in the amino acid limited regime, protein synthesis occurs only transiently for less than an hour under these conditions and YFP synthesis rates from all yfp variants drop below measurable levels at the end of this time period (Fig. S15). More importantly, there is no extended steady state during which differential protein synthesis rates can be measured accurately. Nevertheless, we have confirmed that the measurements with and without methyl esters give qualitatively similar results (Fig. S16). In addition, Western blotting done in the absence of methyl ester reproduced the heirarchy in protein levels between synonymous variants of YFP during amino acid limitation (Fig. S1).

In contrast to the assay without methyl ester, presence of methyl ester analogs in the growth medium results in a quasi-steady state of amino acid limited growth due to hydrolysis of the ester, during which differential YFP expression can be measured easily (Fig. S15). Such partial amino acid limited growth is also likely to be the relevant scenario when prototrophic strains run out of amino acids in their growth media and have a limited supply of amino acids through protein degradation or partially up-regulated biosynthesis pathways.

12.2 Effect of varying the initial concentrations of amino acids and methyl esters

Increasing the initial concentration of the amino acid or its methyl ester results in a higher cell density for the onset of amino acid limitation, and when the corresponding concentrations are decreased, this onset happens at a lower cell density. Importantly, the observed differential robustness of protein synthesis (such as the data shown in Fig. 1D) is qualitatively the same upon 2-fold changes to the initial concentration of either the amino acid or its methyl ester. As an extreme example, see Figs. S15 and S16 for comparison between the cases with and without methyl ester analog in the growth medium.

Table S1: 92 E. coli ORF-yfp fusions used for Leu CRI validation


Genes are arranged by increasing values of Leu CRI. $S_{Leu-rich}$ and $S_{Leu-limited}$ refer to respective protein synthesis rates (a.u. per sec per cell). Robustness refers to the ratio between the two protein synthesis rates after normalization by the corresponding value for the CTG variant of yfp (which is the yfp tag in these ORF-yfp fusions). $\pm$ refers to standard error of measurement.
Number	Gene	$S_{Leu-rich}$	$S_{Leu-limited}$	Robustness	log2(Leu CRI)	Gene product
1	polB	10.4 $\pm$ 0.3	0.6 $\pm$ 0.6	0.063 $\pm$ 0.062	-19.45	DNA polymerase II
2	thiH	69.7 $\pm$ 1.1	-0.7 $\pm$ 0.8	-0.012 $\pm$ 0.013	-14.52	tyrosine lyase, involved in thiamin-thiazolemoiety synthesis
3	aat	26.7 $\pm$ 0.8	1.3 $\pm$ 0.3	0.054 $\pm$ 0.015	-12.52	leucyl/phenylalanyl-tRNA-protein transferase
4	gdhA	20.4 $\pm$ 0.3	-0.2 $\pm$ 0.2	-0.013 $\pm$ 0.009	-11.62	glutamate dehydrogenase, NADP-specific
5	serC	91.3 $\pm$ 0.5	-1.7 $\pm$ 0.6	-0.020 $\pm$ 0.008	-11.6	3-phosphoserine/phosphohydroxy threonine aminotransferase
6	gpsA	111.8 $\pm$ 3.3	1.9 $\pm$ 1.9	0.020 $\pm$ 0.018	-11.38	glycerol-3-phosphate dehydrogenase (NAD+)
7	mlrA	44.1 $\pm$ 1.5	-0.7 $\pm$ 0.8	-0.017 $\pm$ 0.019	-11.09	DNA-binding transcriptional regulator
8	ybeU	41.5 $\pm$ 7.6	0.5 $\pm$ 0.3	0.017 $\pm$ 0.013	-11	conserved protein, DUF1266 family
9	argS	67.6 $\pm$ 1.9	1.0 $\pm$ 0.6	0.017 $\pm$ 0.010	-10.93	arginyl-tRNA synthetase
10	ilvD	59.2 $\pm$ 5.6	3.4 $\pm$ 0.9	0.064 $\pm$ 0.017	-10.39	dihydroxyacid dehydratase
11	ugpC	88.5 $\pm$ 2.7	1.9 $\pm$ 0.9	0.023 $\pm$ 0.011	-10.33	glycerol-3-phosphate transporter subunit
12	argI	44.5 $\pm$ 4.5	5.3 $\pm$ 2.6	0.138 $\pm$ 0.067	-10.24	ornithine carbamoyltransferase 1
13	ttdA	86.1 $\pm$ 0.2	-0.0 $\pm$ 0.5	-0.000 $\pm$ 0.006	-10.06	L-tartrate dehydratase, alpha subunit
14	leuS	143.4 $\pm$ 3.7	-2.5 $\pm$ 0.5	-0.019 $\pm$ 0.003	-9.46	leucyl-tRNA synthetase
15	hisB	119.8 $\pm$ 3.7	-0.3 $\pm$ 3.0	-0.002 $\pm$ 0.027	-9.31	fusedhistidinol-phosphatase/imidazoleglycerol-phosphatedehydratase
16	rpoA	71.8 $\pm$ 7.5	0.0 $\pm$ 0.6	-0.001 $\pm$ 0.009	-9.05	RNA polymerase, alpha subunit
17	uvrY	173.2 $\pm$ 8.8	-5.2 $\pm$ 9.3	-0.027 $\pm$ 0.061	-8.36	DNA-binding response regulator in two-component regulatory system with BarA
18	rob	24.9 $\pm$ 0.7	0.5 $\pm$ 0.2	0.024 $\pm$ 0.007	-7.94	right oriC-binding transcriptional activator,AraC family
19	agaS	73.0 $\pm$ 3.3	1.3 $\pm$ 0.4	0.019 $\pm$ 0.005	-7.48	tagatose-6-phosphate ketose/aldose isomerase
20	lysS	111.8 $\pm$ 4.4	3.7 $\pm$ 2.1	0.035 $\pm$ 0.020	-7.17	lysine tRNA synthetase, constitutive
21	sdaB	121.0 $\pm$ 5.7	36.4 $\pm$ 4.1	0.333 $\pm$ 0.044	-7.14	L-serine deaminase II
22	purA	35.5 $\pm$ 2.2	-1.2 $\pm$ 0.4	-0.039 $\pm$ 0.015	-7.12	adenylosuccinate synthetase
23	rpoD	77.5 $\pm$ 2.2	2.3 $\pm$ 1.1	0.032 $\pm$ 0.014	-6.99	RNA polymerase, sigma 70 (sigma D) factor
24	melR	44.5 $\pm$ 3.3	15.1 $\pm$ 0.4	0.378 $\pm$ 0.031	-6.76	DNA-binding transcriptional dual regulator
25	kefF	99.2 $\pm$ 3.0	3.3 $\pm$ 0.5	0.038 $\pm$ 0.007	-6.52	flavoprotein subunit for the KefC potassium efflux system
26	uhpA	22.4 $\pm$ 1.5	0.4 $\pm$ 0.7	0.019 $\pm$ 0.034	-6.5	DNA-binding response regulator in two-component regulatory system wtih UhpB
27	ydcN	41.6 $\pm$ 2.7	1.9 $\pm$ 0.7	0.050 $\pm$ 0.015	-6.5	predicted DNA-binding transcriptional regulator
28	aspS	62.3 $\pm$ 4.2	10.9 $\pm$ 1.5	0.191 $\pm$ 0.014	-6.42	aspartyl-tRNA synthetase
29	relB	87.9 $\pm$ 2.3	0.8 $\pm$ 0.9	0.009 $\pm$ 0.010	-6.09	Qin prophage; bifunctional antitoxin of theRelE-RelB toxin-antitoxin system/ transcriptional repressor
30	guaA	122.6 $\pm$ 2.3	6.9 $\pm$ 2.2	0.061 $\pm$ 0.019	-5.81	GMP synthetase (glutamine aminotransferase)
31	phnM	203.7 $\pm$ 9.5	20.9 $\pm$ 1.2	0.113 $\pm$ 0.007	-5.81	carbon-phosphorus lyase complex subunit
32	tdcD	4.5 $\pm$ 0.4	7.1 $\pm$ 0.2	1.755 $\pm$ 0.163	-5.76	propionate kinase/acetate kinase C, anaerobic
33	ompR	114.2 $\pm$ 18.7	-1.4 $\pm$ 2.2	-0.019 $\pm$ 0.027	-5.74	DNA-binding response regulator in two-component regulatory system with EnvZ
34	phnL	75.7 $\pm$ 5.3	5.7 $\pm$ 1.1	0.082 $\pm$ 0.013	-5.51	carbon-phosphorus lyase complex subunit
35	purH	29.6 $\pm$ 1.4	10.2 $\pm$ 0.4	0.383 $\pm$ 0.025	-5.27	fused IMPcyclohydrolase / phosphoribosyl aminoimidazole carboxamide formyltransferase
36	argG	2.5 $\pm$ 0.2	3.0 $\pm$ 0.2	1.343 $\pm$ 0.150	-5.07	argininosuccinate synthetase
37	rimM	107.5 $\pm$ 3.7	13.3 $\pm$ 0.9	0.137 $\pm$ 0.014	-4.95	16S rRNA processing protein
38	ubiC	93.6 $\pm$ 3.9	7.5 $\pm$ 2.2	0.087 $\pm$ 0.022	-4.87	chorismate–pyruvate lyase
39	leuL	48.9 $\pm$ 2.3	0.7 $\pm$ 0.5	0.017 $\pm$ 0.011	-4.75	leu operon leader peptide
40	asnS	9.0 $\pm$ 0.4	7.2 $\pm$ 0.5	0.884 $\pm$ 0.071	-4.65	asparaginyl tRNA synthetase
41	ribB	107.6 $\pm$ 7.8	12.2 $\pm$ 1.0	0.127 $\pm$ 0.020	-4.49	3,4-dihydroxy-2-butanone-4-phosphate synthase
42	smpB	15.8 $\pm$ 0.8	1.5 $\pm$ 0.4	0.101 $\pm$ 0.023	-4.39	trans-translation protein
43	guaB	31.0 $\pm$ 0.3	5.2 $\pm$ 0.6	0.184 $\pm$ 0.022	-4.21	IMP dehydrogenase
44	proC	69.2 $\pm$ 3.1	9.4 $\pm$ 1.6	0.151 $\pm$ 0.030	-3.92	pyrroline-5-carboxylate reductase,NAD(P)-binding
45	pth	89.0 $\pm$ 2.6	25.2 $\pm$ 0.9	0.313 $\pm$ 0.018	-3.1	peptidyl-tRNA hydrolase
46	ivbL	1.8 $\pm$ 0.3	1.6 $\pm$ 0.1	1.085 $\pm$ 0.295	-2.89	ilvB operon leader peptide
47	chbR	25.6 $\pm$ 1.0	24.4 $\pm$ 0.8	1.054 $\pm$ 0.008	-2.81	rRepressor, chb operon forN,N’-diacetylchitobiose utilization
48	leuA	78.1 $\pm$ 2.2	53.6 $\pm$ 0.8	0.756 $\pm$ 0.019	-2.77	2-isopropylmalate synthase
49	argD	85.7 $\pm$ 4.4	51.0 $\pm$ 1.8	0.657 $\pm$ 0.031	-2.72	bifunctional acetylornithine aminotransferase/succinyldiaminopimelate aminotransferase
50	yfcN	98.8 $\pm$ 2.1	24.2 $\pm$ 1.5	0.270 $\pm$ 0.011	-2.71	conserved protein
51	ygiD	7.3 $\pm$ 0.3	9.9 $\pm$ 0.4	1.503 $\pm$ 0.046	-2.62	predicted dioxygenase, LigB family
52	mdtJ	12.5 $\pm$ 1.6	17.5 $\pm$ 0.2	1.595 $\pm$ 0.204	-2.52	multidrug efflux system transporter
53	agaR	80.6 $\pm$ 2.5	31.4 $\pm$ 2.0	0.428 $\pm$ 0.018	-2.39	DNA-binding transcriptional repressor of the aga regulon
54	hisA	22.0 $\pm$ 0.9	27.6 $\pm$ 0.9	1.392 $\pm$ 0.087	-1.86	N-(5’-phospho-L-ribosyl-formimino)-5-amino-1-(5’-phosphoribosyl)-4-imidazolecarb oxamide isomerase
55	ygbF	72.7 $\pm$ 21.5	26.4 $\pm$ 1.3	0.475 $\pm$ 0.130	-1.65	probable ssRNA endonuclease, CRISP-associatedprotein
56	rpoH	89.2 $\pm$ 1.8	50.5 $\pm$ 0.9	0.623 $\pm$ 0.005	-1.53	RNA polymerase, sigma 32 (sigma H) factor
57	leuD	128.4 $\pm$ 2.7	70.0 $\pm$ 0.6	0.601 $\pm$ 0.018	-1.48	3-isopropylmalate dehydratase small subunit
58	dinJ	58.9 $\pm$ 2.8	34.4 $\pm$ 1.5	0.648 $\pm$ 0.050	-1.48	antitoxin of YafQ-DinJ toxin-antitoxin system
59	nuoI	25.2 $\pm$ 1.8	30.6 $\pm$ 1.4	1.361 $\pm$ 0.164	-1.48	NADH:ubiquinone oxidoreductase, chain I
60	luxS	109.5 $\pm$ 0.7	70.3 $\pm$ 3.9	0.706 $\pm$ 0.035	-1.34	S-ribosylhomocysteine lyase
61	leuC	104.5 $\pm$ 6.0	54.0 $\pm$ 3.4	0.573 $\pm$ 0.069	-1.18	3-isopropylmalate dehydratase large subunit
62	pspA	69.8 $\pm$ 2.6	51.4 $\pm$ 0.6	0.813 $\pm$ 0.039	-1.18	regulatory protein for phage-shock-proteinoperon
63	pyrI	138.9 $\pm$ 13.7	112.5 $\pm$ 6.2	0.906 $\pm$ 0.091	-1.15	aspartate carbamoyltransferase, regulatorysubunit
64	btuE	149.1 $\pm$ 4.6	132.9 $\pm$ 3.6	0.982 $\pm$ 0.020	-0.95	glutathione peroxidase
65	msrB	153.6 $\pm$ 14.7	131.7 $\pm$ 2.8	0.958 $\pm$ 0.074	-0.8	methionine sulfoxide reductase B
66	coaD	94.4 $\pm$ 0.3	96.2 $\pm$ 0.8	1.122 $\pm$ 0.012	-0.71	pantetheine-phosphate adenylyltransferase
67	sfsB	72.2 $\pm$ 2.4	18.9 $\pm$ 1.5	0.291 $\pm$ 0.032	-0.61	DNA-binding transcriptional activator of maltosemetabolism
68	nirD	113.2 $\pm$ 17.8	22.1 $\pm$ 1.5	0.223 $\pm$ 0.027	-0.52	nitrite reductase, NAD(P)H-binding, smallsubunit
69	fdnI	62.4 $\pm$ 1.6	57.8 $\pm$ 3.4	1.019 $\pm$ 0.034	-0.43	formate dehydrogenase-N, cytochrome B556 (gamma)subunit, nitrate-inducible
70	greA	172.5 $\pm$ 12.4	90.0 $\pm$ 1.2	0.581 $\pm$ 0.045	-0.38	transcript cleavage factor
71	hupB	287.5 $\pm$ 19.6	116.5 $\pm$ 4.0	0.450 $\pm$ 0.030	-0.33	HU, DNA-binding transcriptional regulator, betasubunit
72	glpE	144.2 $\pm$ 2.0	142.0 $\pm$ 2.6	1.086 $\pm$ 0.035	-0.33	thiosulfate:cyanide sulfurtransferase(rhodanese)
73	ogrK	95.8 $\pm$ 9.5	145.2 $\pm$ 3.3	1.699 $\pm$ 0.153	-0.33	positive regulator of P2 growth (insertion of P2ogr gene into the chromosome)
74	rplD	20.9 $\pm$ 1.5	41.0 $\pm$ 1.6	2.191 $\pm$ 0.226	-0.33	50S ribosomal subunit protein L4
75	dmsB	116.2 $\pm$ 5.3	156.3 $\pm$ 5.1	1.486 $\pm$ 0.067	-0.28	dimethyl sulfoxide reductase, anaerobic, subunitB
76	rpsP	241.7 $\pm$ 3.7	118.5 $\pm$ 0.3	0.540 $\pm$ 0.007	-0.19	30S ribosomal subunit protein S16
77	rplX	150.6 $\pm$ 3.2	83.7 $\pm$ 3.5	0.613 $\pm$ 0.031	-0.19	50S ribosomal subunit protein L24
78	tpiA	138.5 $\pm$ 11.4	87.1 $\pm$ 2.2	0.700 $\pm$ 0.047	-0.19	triosephosphate isomerase
79	gapA	39.5 $\pm$ 2.0	62.6 $\pm$ 1.6	1.757 $\pm$ 0.135	-0.19	glyceraldehyde-3-phosphate dehydrogenase A
80	rpsT	174.7 $\pm$ 12.0	133.7 $\pm$ 4.5	0.849 $\pm$ 0.050	-0.14	30S ribosomal subunit protein S20
81	rpsJ	170.2 $\pm$ 37.2	142.3 $\pm$ 1.6	1.015 $\pm$ 0.219	-0.14	30S ribosomal subunit protein S10
82	rplT	120.5 $\pm$ 8.5	112.6 $\pm$ 3.7	1.039 $\pm$ 0.077	-0.14	50S ribosomal subunit protein L20
83	ahpC	57.0 $\pm$ 5.0	64.9 $\pm$ 1.7	1.267 $\pm$ 0.078	-0.14	alkyl hydroperoxide reductase, C22 subunit
84	rpsK	109.9 $\pm$ 9.2	139.0 $\pm$ 3.5	1.411 $\pm$ 0.113	-0.14	30S ribosomal subunit protein S11
85	tsf	200.4 $\pm$ 2.8	103.8 $\pm$ 2.1	0.570 $\pm$ 0.008	0	protein chain elongation factor EF-Ts
86	rplU	173.3 $\pm$ 12.4	92.5 $\pm$ 4.9	0.595 $\pm$ 0.056	0	50S ribosomal subunit protein L21
87	rpmI	158.7 $\pm$ 4.0	104.2 $\pm$ 1.4	0.725 $\pm$ 0.025	0	50S ribosomal subunit protein L35
88	yjgF	131.9 $\pm$ 5.3	98.1 $\pm$ 3.0	0.824 $\pm$ 0.057	0	conserved protein, UPF0131 family
89	ppiB	133.6 $\pm$ 4.5	114.6 $\pm$ 2.7	0.945 $\pm$ 0.011	0	peptidyl-prolyl cis-trans isomerase B (rotamaseB)
90	yjbJ	134.6 $\pm$ 4.4	158.7 $\pm$ 1.1	1.300 $\pm$ 0.035	0	conserved protein, UPF0337 family
91	rpsI	27.5 $\pm$ 2.8	78.6 $\pm$ 6.0	3.198 $\pm$ 0.324	0	30S ribosomal subunit protein S9
92	rpsF	31.7 $\pm$ 1.6	97.1 $\pm$ 0.8	3.392 $\pm$ 0.183	0	30S ribosomal subunit protein S6

Table S2: 56 E. coli ORF-yfp fusions used for Arg CRI validation

Genes are arranged by increasing values of Arg CRI. $S_{Arg-rich}$ and $S_{Arg-limited}$ refer to respective protein synthesis rates (a.u. per sec per cell). Robustness refers to the ratio between the two protein synthesis rates after normalization by the corresponding value for the AGA variant of yfp (this AGA variant was also used as the yfp tag in these ORF-yfp fusions). $\pm$ refers to standard error of measurement.
Number	Gene	$S_{Arg-rich}$	$S_{Arg-limited}$	Robustness	log2(Arg CRI)	Gene product
1	leuS	100.5 $\pm$ 2.6	16.1 $\pm$ 1.7	0.107 $\pm$ 0.012	-10.05	leucyl-tRNA synthetase
2	phoR	16.4 $\pm$ 3.2	0.7 $\pm$ 0.6	0.027 $\pm$ 0.029	-8.52	sensory histidine kinase in two-componentregulatory system with PhoB
3	glnG	61.0 $\pm$ 3.4	10.8 $\pm$ 2.3	0.118 $\pm$ 0.022	-8.51	fused DNA-binding response regulator intwo-component regulatory system with GlnL: responseregulator/sigma54 interaction protein
4	asnS	15.5 $\pm$ 1.8	2.6 $\pm$ 0.1	0.114 $\pm$ 0.014	-8.38	asparaginyl tRNA synthetase
5	guaA	91.5 $\pm$ 4.2	11.7 $\pm$ 3.7	0.083 $\pm$ 0.024	-8.25	GMP synthetase (glutamine aminotransferase)
6	thiH	53.9 $\pm$ 1.1	4.4 $\pm$ 1.3	0.054 $\pm$ 0.015	-7.16	tyrosine lyase, involved in thiamin-thiazolemoiety synthesis
7	fruR	44.7 $\pm$ 1.5	5.3 $\pm$ 0.1	0.079 $\pm$ 0.004	-6.54	DNA-binding transcriptional dual regulator
8	argG	10.0 $\pm$ 0.9	2.5 $\pm$ 1.1	0.175 $\pm$ 0.088	-6.49	argininosuccinate synthetase
9	gpsA	81.9 $\pm$ 3.9	9.1 $\pm$ 4.2	0.073 $\pm$ 0.032	-5.81	glycerol-3-phosphate dehydrogenase (NAD+)
10	rpoA	60.9 $\pm$ 1.6	10.5 $\pm$ 2.1	0.114 $\pm$ 0.022	-5.36	RNA polymerase, alpha subunit
11	yiiD	31.2 $\pm$ 1.8	9.8 $\pm$ 2.9	0.218 $\pm$ 0.078	-5.05	predicted acetyltransferase
12	agaR	53.2 $\pm$ 1.8	2.6 $\pm$ 0.8	0.032 $\pm$ 0.010	-5.01	DNA-binding transcriptional repressor of the agaregulon
13	rimK	17.9 $\pm$ 2.6	9.8 $\pm$ 1.5	0.393 $\pm$ 0.106	-4.94	ribosomal protein S6 modification protein
14	rpoH	75.2 $\pm$ 2.8	9.3 $\pm$ 2.9	0.081 $\pm$ 0.023	-4.76	RNA polymerase, sigma 32 (sigma H) factor
15	melR	43.7 $\pm$ 0.4	11.1 $\pm$ 2.3	0.170 $\pm$ 0.036	-4.46	DNA-binding transcriptional dual regulator
16	tdcB	32.1 $\pm$ 2.0	10.2 $\pm$ 2.9	0.208 $\pm$ 0.051	-3.83	catabolic threonine dehydratase, PLP-dependent
17	serC	68.2 $\pm$ 2.3	28.9 $\pm$ 4.2	0.284 $\pm$ 0.043	-3.79	3-phosphoserine/phosphohydroxy threonine aminotransferase
18	rnc	65.7 $\pm$ 2.5	15.4 $\pm$ 2.6	0.157 $\pm$ 0.028	-3.74	RNase III
19	chbR	22.3 $\pm$ 1.2	6.2 $\pm$ 2.1	0.190 $\pm$ 0.064	-3.66	rRepressor, chb operon forN,N’-diacetylchitobiose utilization
20	rsuA	100.3 $\pm$ 5.9	12.8 $\pm$ 2.8	0.084 $\pm$ 0.015	-3.65	16S rRNA U516 pseudouridine synthase
21	tauC	70.1 $\pm$ 3.2	7.4 $\pm$ 1.3	0.071 $\pm$ 0.016	-3.5	taurine transporter subunit
22	smpB	55.3 $\pm$ 1.3	17.5 $\pm$ 0.8	0.211 $\pm$ 0.010	-3.42	trans-translation protein
23	carA	28.2 $\pm$ 1.1	14.0 $\pm$ 0.8	0.331 $\pm$ 0.005	-3.4	carbamoyl phosphate synthetase small subunit,glutamine amidotransferase
24	ubiC	70.6 $\pm$ 1.8	4.7 $\pm$ 1.9	0.044 $\pm$ 0.018	-3.39	chorismate–pyruvate lyase
25	pth	71.2 $\pm$ 2.4	20.0 $\pm$ 0.8	0.187 $\pm$ 0.001	-3.21	peptidyl-tRNA hydrolase
26	rpsF	26.6 $\pm$ 1.9	14.7 $\pm$ 2.3	0.366 $\pm$ 0.043	-3.06	30S ribosomal subunit protein S6
27	gapA	34.3 $\pm$ 0.9	12.1 $\pm$ 1.9	0.234 $\pm$ 0.030	-2.86	glyceraldehyde-3-phosphate dehydrogenase A
28	yihL	43.2 $\pm$ 3.4	6.7 $\pm$ 1.1	0.105 $\pm$ 0.022	-2.85	predicted DNA-binding transcriptional regulator
29	allR	36.0 $\pm$ 1.5	17.1 $\pm$ 0.8	0.318 $\pm$ 0.026	-2.82	DNA-binding transcriptional repressor for all(allantoin) and gcl (glyoxylate) operons;glyoxylate-induced
30	yfcN	74.2 $\pm$ 4.8	38.9 $\pm$ 7.3	0.353 $\pm$ 0.068	-2.8	conserved protein
31	fdnI	42.7 $\pm$ 1.8	17.8 $\pm$ 3.2	0.277 $\pm$ 0.042	-2.65	formate dehydrogenase-N, cytochrome B556 (gamma)subunit, nitrate-inducible
32	ruvA	53.2 $\pm$ 4.1	26.7 $\pm$ 1.1	0.341 $\pm$ 0.040	-2.59	component of RuvABC resolvasome, regulatorysubunit
33	adiY	47.5 $\pm$ 8.2	6.1 $\pm$ 0.9	0.086 $\pm$ 0.003	-2.55	DNA-binding transcriptional activator
34	holD	15.1 $\pm$ 3.6	2.9 $\pm$ 1.3	0.153 $\pm$ 0.066	-2.43	DNA polymerase III, psi subunit
35	dmsB	68.1 $\pm$ 2.2	54.7 $\pm$ 6.5	0.537 $\pm$ 0.067	-2.42	dimethyl sulfoxide reductase, anaerobic, subunitB
36	bglJ	10.5 $\pm$ 1.3	6.6 $\pm$ 0.7	0.420 $\pm$ 0.010	-2.39	DNA-binding transcriptional activator for silentbgl operon, requires the bglJ4 allele to function; LuxRfamily
37	yfdT	71.4 $\pm$ 1.4	17.6 $\pm$ 0.7	0.164 $\pm$ 0.005	-2.32	CPS-53 (KpLE1) prophage; predicted protein
38	argF	64.9 $\pm$ 2.8	35.7 $\pm$ 2.5	0.371 $\pm$ 0.044	-2.01	ornithine carbamoyltransferase 2, chain F; CP4-6prophage
39	rplU	102.0 $\pm$ 7.4	20.5 $\pm$ 4.2	0.134 $\pm$ 0.029	-1.89	50S ribosomal subunit protein L21
40	luxS	90.3 $\pm$ 1.4	54.9 $\pm$ 2.4	0.406 $\pm$ 0.018	-1.77	S-ribosylhomocysteine lyase
41	coaD	70.9 $\pm$ 1.5	45.3 $\pm$ 3.4	0.426 $\pm$ 0.036	-1.75	pantetheine-phosphate adenylyltransferase
42	glnB	199.0 $\pm$ 6.0	61.9 $\pm$ 7.2	0.207 $\pm$ 0.021	-1.75	regulatory protein P-II for glutaminesynthetase
43	uidR	32.2 $\pm$ 1.7	35.7 $\pm$ 1.5	0.745 $\pm$ 0.064	-1.5	DNA-binding transcriptional repressor
44	relB	69.6 $\pm$ 4.3	29.8 $\pm$ 0.5	0.287 $\pm$ 0.016	-1.35	Qin prophage; bifunctional antitoxin of theRelE-RelB toxin-antitoxin system/ transcriptionalrepressor
45	btuE	106.1 $\pm$ 1.4	52.7 $\pm$ 4.0	0.331 $\pm$ 0.021	-1.35	glutathione peroxidase
46	argR	37.3 $\pm$ 3.4	13.7 $\pm$ 4.4	0.235 $\pm$ 0.054	-1.19	DNA-binding transcriptional dual regulator,L-arginine-binding
47	ogrK	53.3 $\pm$ 1.5	29.3 $\pm$ 0.9	0.367 $\pm$ 0.013	-1.14	positive regulator of P2 growth (insertion of P2ogr gene into the chromosome)
48	hupB	127.5 $\pm$ 3.6	71.2 $\pm$ 1.0	0.373 $\pm$ 0.008	-1.13	HU, DNA-binding transcriptional regulator, betasubunit
49	ppiB	95.0 $\pm$ 2.7	57.2 $\pm$ 10.5	0.401 $\pm$ 0.069	-1.13	peptidyl-prolyl cis-trans isomerase B (rotamaseB)
50	yjgF	92.2 $\pm$ 4.7	74.4 $\pm$ 3.6	0.540 $\pm$ 0.032	-1.13	conserved protein, UPF0131 family
51	kefF	68.6 $\pm$ 2.5	69.7 $\pm$ 7.6	0.677 $\pm$ 0.058	-1.11	flavoprotein subunit for the KefC potassiumefflux system
52	yjbJ	92.0 $\pm$ 5.1	96.6 $\pm$ 30.0	0.730 $\pm$ 0.272	-1.02	conserved protein, UPF0337 family
53	leuL	36.7 $\pm$ 1.4	31.8 $\pm$ 2.2	0.577 $\pm$ 0.023	-0.97	leu operon leader peptide
54	rimM	86.4 $\pm$ 1.7	89.9 $\pm$ 3.3	0.694 $\pm$ 0.029	-0.82	16S rRNA processing protein
55	ydjO	9.9 $\pm$ 0.9	20.7 $\pm$ 1.6	1.432 $\pm$ 0.219	-0.74	predicted protein
56	mdtJ	21.0 $\pm$ 0.4	26.4 $\pm$ 1.5	0.841 $\pm$ 0.060	-0.41	multidrug efflux system transporter

Table S3: 21 E. coli ORF-yfp fusions co-expressed with

{}^{\textrm{GAG}}

Leu2 tRNA

Genes are arranged by increasing values of Leu CRI as calculated for ${}^{\textrm{GAG}}$ Leu2 tRNA co-expression. $S_{Leu-rich}$ and $S_{Leu-limited}$ refer to respective protein synthesis rates (a.u. per sec per cell) under ${}^{\textrm{GAG}}$ Leu2 tRNA co-expression. Robustness refers to the ratio between the two protein synthesis rates after normalization by the corresponding value for the CTG variant of yfp (see Fig. 1D). $\pm$ refers to standard error of measurement. Refer to Table LABEL:92orfs for corresponding values without ${}^{\textrm{GAG}}$ Leu2 tRNA co-expression.
Number	Gene	$S_{Leu-rich}$	$S_{Leu-limited}$	Robustness	log2(Leu CRI)	Gene product
1	ygiD	8.2 $\pm$ 0.6	3.8 $\pm$ 0.8	0.515 $\pm$ 0.103	-5.69	predicted dioxygenase, LigB family
2	chbR	26.5 $\pm$ 2.5	7.3 $\pm$ 1.5	0.299 $\pm$ 0.043	-5.68	rRepressor, chb operon forN,N’-diacetylchitobiose utilization
3	yfcN	92.7 $\pm$ 2.6	12.1 $\pm$ 2.9	0.142 $\pm$ 0.030	-5.47	conserved protein
4	mdtJ	12.7 $\pm$ 0.8	5.7 $\pm$ 1.7	0.513 $\pm$ 0.165	-4.46	multidrug efflux system transporter
5	ilvD	62.5 $\pm$ 1.5	23.6 $\pm$ 0.8	0.417 $\pm$ 0.022	-4.29	dihydroxyacid dehydratase
6	aspS	54.1 $\pm$ 2.0	18.5 $\pm$ 1.8	0.379 $\pm$ 0.046	-4.24	aspartyl-tRNA synthetase
7	lysS	106.3 $\pm$ 4.7	35.2 $\pm$ 0.8	0.367 $\pm$ 0.025	-4.22	lysine tRNA synthetase, constitutive
8	leuC	100.7 $\pm$ 0.5	19.0 $\pm$ 1.7	0.208 $\pm$ 0.019	-4.04	3-isopropylmalate dehydratase large subunit
9	ygbF	69.4 $\pm$ 3.4	8.1 $\pm$ 0.4	0.129 $\pm$ 0.009	-3.99	probable ssRNA endonuclease, CRISP-associated protein
10	pspA	65.1 $\pm$ 1.2	25.9 $\pm$ 2.0	0.437 $\pm$ 0.025	-3.91	regulatory protein for phage-shock-protein operon
11	guaA	122.0 $\pm$ 2.8	51.1 $\pm$ 1.9	0.462 $\pm$ 0.018	-3.27	GMP synthetase (glutamine aminotransferase)
12	btuE	137.7 $\pm$ 4.6	57.5 $\pm$ 3.9	0.462 $\pm$ 0.044	-3.23	glutathione peroxidase
13	purA	73.3 $\pm$ 1.8	34.8 $\pm$ 2.7	0.522 $\pm$ 0.035	-3.16	adenylosuccinate synthetase
14	ompR	116.4 $\pm$ 1.0	50.7 $\pm$ 3.2	0.479 $\pm$ 0.027	-2.86	DNA-binding response regulator in two-component regulatory system with EnvZ
15	phnM	68.2 $\pm$ 4.4	48.4 $\pm$ 1.4	0.786 $\pm$ 0.044	-2.72	carbon-phosphorus lyase complex subunit
16	msrB	113.4 $\pm$ 3.1	37.9 $\pm$ 2.1	0.370 $\pm$ 0.028	-2.68	methionine sulfoxide reductase B
17	purH	71.4 $\pm$ 1.3	7.9 $\pm$ 2.0	0.120 $\pm$ 0.028	-2.61	fused IMPcyclohydrolase/phosphoribosyl aminoimidazole carboxamide formyltransferase
18	coaD	98.3 $\pm$ 7.4	46.7 $\pm$ 1.9	0.526 $\pm$ 0.018	-2.58	pantetheine-phosphate adenylyltransferase
19	rimM	114.3 $\pm$ 5.9	51.3 $\pm$ 1.1	0.498 $\pm$ 0.030	-1.99	16S rRNA processing protein
20	relB	79.9 $\pm$ 3.0	66.6 $\pm$ 3.3	0.923 $\pm$ 0.077	-1.73	Qin prophage; bifunctional antitoxin of theRelE-RelB toxin-antitoxin system/ transcriptional repressor
21	proC	78.1 $\pm$ 2.0	36.7 $\pm$ 4.4	0.519 $\pm$ 0.070	-1.72	pyrroline-5-carboxylate reductase,NAD(P)-binding

Table S4: 63 synonymous mutants of 13 E. coli ORF-yfp fusions

$S_{Leu-rich}$ and $S_{Leu-limited}$ refer to respective protein synthesis rates (a.u. per sec per cell) of mutant ORFs. Robustness refers to the ratio between the two protein synthesis rates after normalization by the corresponding value for the CTG variant of yfp (see Fig. 1D). $\pm$ refers to standard error of measurement. Refer to Table LABEL:92orfs for corresponding values of wild-type ORFs. The DNA sequence of the mutant variants below is provided in the gene_sequences.fasta file. Three of the sequences below did not have any mutations compared to the wild-type ORF and were included as internal controls.
Number	Gene	$S_{Leu-rich}$	$S_{Leu-limited}$	Robustness	log2(Leu CRI)
1	btuE-yfp mutant 1	137.0 $\pm$ 5.3	50.1 $\pm$ 1.1	0.403 $\pm$ 0.007	-2.22
2	btuE-yfp mutant 4	131.5 $\pm$ 3.5	20.5 $\pm$ 0.5	0.172 $\pm$ 0.009	-3.06
3	btuE-yfp mutant 5	138.9 $\pm$ 1.8	34.1 $\pm$ 0.1	0.270 $\pm$ 0.003	-2.62
4	btuE-yfp mutant 7	123.4 $\pm$ 4.9	48.2 $\pm$ 1.8	0.433 $\pm$ 0.032	-2.22
5	btuE-yfp mutant 8	130.7 $\pm$ 5.2	28.8 $\pm$ 0.9	0.243 $\pm$ 0.015	-3.06
6	btuE-yfp mutant 9	128.9 $\pm$ 0.9	40.0 $\pm$ 0.6	0.342 $\pm$ 0.003	-2.62
7	chbR-yfp mutant 1	29.5 $\pm$ 1.7	17.7 $\pm$ 0.3	0.663 $\pm$ 0.028	-2.81
8	chbR-yfp mutant 2	26.7 $\pm$ 2.2	15.1 $\pm$ 0.4	0.634 $\pm$ 0.072	-3.25
9	chbR-yfp mutant 3	31.7 $\pm$ 0.9	11.3 $\pm$ 0.6	0.393 $\pm$ 0.029	-5.31
10	chbR-yfp mutant 4	36.0 $\pm$ 2.5	9.0 $\pm$ 0.3	0.279 $\pm$ 0.027	-6.2
11	chbR-yfp mutant 5	28.9 $\pm$ 2.4	10.7 $\pm$ 0.2	0.414 $\pm$ 0.033	-5.76
12	chbR-yfp mutant 6	32.6 $\pm$ 2.7	5.7 $\pm$ 0.5	0.197 $\pm$ 0.021	-7.03
13	chbR-yfp mutant 7	32.1 $\pm$ 1.2	7.7 $\pm$ 0.5	0.267 $\pm$ 0.023	-5.8
14	chbR-yfp mutant 9	31.3 $\pm$ 0.9	7.9 $\pm$ 0.5	0.278 $\pm$ 0.026	-6.64
15	coaD-yfp mutant 1	92.3 $\pm$ 1.3	39.1 $\pm$ 1.3	0.467 $\pm$ 0.021	-1.89
16	coaD-yfp mutant 2	91.7 $\pm$ 4.1	55.5 $\pm$ 0.8	0.669 $\pm$ 0.034	-1.1
17	coaD-yfp mutant 3	94.0 $\pm$ 2.4	47.7 $\pm$ 2.3	0.558 $\pm$ 0.014	-1.5
18	leuA-yfp mutant 6	70.5 $\pm$ 2.1	11.3 $\pm$ 0.3	0.177 $\pm$ 0.010	-4.4
19	leuA-yfp mutant 8	77.9 $\pm$ 2.2	6.6 $\pm$ 1.4	0.093 $\pm$ 0.020	-5.23
20	leuA-yfp mutant 9	70.0 $\pm$ 2.1	8.4 $\pm$ 0.2	0.132 $\pm$ 0.007	-4.84
21	leuB-yfp mutant 7	273.5 $\pm$ 8.7	6.1 $\pm$ 0.9	0.025 $\pm$ 0.003	-4.81
22	leuB-yfp mutant 8	273.3 $\pm$ 10.6	9.6 $\pm$ 1.0	0.039 $\pm$ 0.005	-4.02
23	leuB-yfp mutant 9	274.9 $\pm$ 8.1	8.4 $\pm$ 1.7	0.034 $\pm$ 0.007	-3.97
24	leuC-yfp mutant 5	86.8 $\pm$ 0.6	8.5 $\pm$ 1.7	0.108 $\pm$ 0.021	-3.64
25	leuC-yfp mutant 7	95.6 $\pm$ 1.9	5.1 $\pm$ 1.7	0.059 $\pm$ 0.019	-3.3
26	leuC-yfp mutant 8	100.5 $\pm$ 1.7	4.3 $\pm$ 0.9	0.047 $\pm$ 0.009	-3.69
27	leuC-yfp mutant 9	80.0 $\pm$ 4.9	14.3 $\pm$ 0.8	0.198 $\pm$ 0.013	-3.25
28	leuD-yfp mutant 2	123.6 $\pm$ 0.9	18.3 $\pm$ 1.2	0.163 $\pm$ 0.011	-2.76
29	leuD-yfp mutant 3	123.1 $\pm$ 3.7	39.5 $\pm$ 1.0	0.355 $\pm$ 0.020	-1.48
30	leuD-yfp mutant 4	122.0 $\pm$ 1.0	32.9 $\pm$ 0.3	0.297 $\pm$ 0.002	-1.92
31	mdtJ-yfp mutant 1	17.3 $\pm$ 0.6	9.1 $\pm$ 0.4	0.580 $\pm$ 0.020	-4.15
32	mdtJ-yfp mutant 2	12.2 $\pm$ 0.5	5.8 $\pm$ 0.3	0.520 $\pm$ 0.008	-3.31
33	mdtJ-yfp mutant 4	10.0 $\pm$ 0.9	4.3 $\pm$ 0.1	0.475 $\pm$ 0.047	-4.54
34	mdtJ-yfp mutant 5	13.6 $\pm$ 2.1	11.4 $\pm$ 0.5	0.979 $\pm$ 0.190	-4.15
35	mdtJ-yfp mutant 6	6.4 $\pm$ 0.9	5.1 $\pm$ 0.1	0.903 $\pm$ 0.125	-3.75
36	mdtJ-yfp mutant 7	5.9 $\pm$ 3.1	4.3 $\pm$ 0.3	1.251 $\pm$ 0.488	-4.15
37	mdtJ-yfp mutant 8	10.2 $\pm$ 1.5	8.3 $\pm$ 0.1	0.932 $\pm$ 0.117	-4.19
38	mdtJ-yfp mutant 9	10.3 $\pm$ 0.8	9.6 $\pm$ 0.2	1.049 $\pm$ 0.087	-3.36
39	msrB-yfp mutant 1	76.6 $\pm$ 1.9	23.7 $\pm$ 0.8	0.342 $\pm$ 0.014	-2.48
40	msrB-yfp mutant 2	65.3 $\pm$ 1.6	20.7 $\pm$ 0.8	0.348 $\pm$ 0.005	-2.92
41	msrB-yfp mutant 3	99.1 $\pm$ 2.7	27.8 $\pm$ 2.5	0.310 $\pm$ 0.031	-2.52
42	msrB-yfp mutant 4	94.0 $\pm$ 1.5	36.2 $\pm$ 0.4	0.424 $\pm$ 0.005	-2.08
43	pspA-yfp mutant 1	68.2 $\pm$ 1.9	16.3 $\pm$ 0.6	0.264 $\pm$ 0.006	-2.81
44	pspA-yfp mutant 2	64.2 $\pm$ 0.5	15.0 $\pm$ 0.7	0.257 $\pm$ 0.011	-2.85
45	pspA-yfp mutant 3	62.3 $\pm$ 1.5	28.5 $\pm$ 0.6	0.505 $\pm$ 0.016	-1.97
46	pspA-yfp mutant 5	73.3 $\pm$ 1.3	14.0 $\pm$ 0.9	0.211 $\pm$ 0.018	-3.2
47	pspA-yfp mutant 6	70.1 $\pm$ 3.0	18.3 $\pm$ 0.9	0.288 $\pm$ 0.013	-2.76
48	pspA-yfp mutant 7	73.5 $\pm$ 1.4	8.5 $\pm$ 0.2	0.127 $\pm$ 0.002	-3.64
49	pspA-yfp mutant 8	73.0 $\pm$ 1.2	12.3 $\pm$ 0.8	0.185 $\pm$ 0.012	-3.25
50	yfcN-yfp mutant 1	103.0 $\pm$ 3.5	8.3 $\pm$ 1.3	0.088 $\pm$ 0.012	-4.82
51	yfcN-yfp mutant 5	86.0 $\pm$ 3.6	14.9 $\pm$ 1.7	0.192 $\pm$ 0.022	-3.1
52	yfcN-yfp mutant 6	90.5 $\pm$ 1.6	5.6 $\pm$ 0.7	0.069 $\pm$ 0.009	-5.31
53	yfcN-yfp mutant 8	91.5 $\pm$ 4.1	14.1 $\pm$ 1.7	0.170 $\pm$ 0.017	-2.71
54	yfcN-yfp mutant 9	85.5 $\pm$ 1.1	5.2 $\pm$ 0.4	0.067 $\pm$ 0.005	-4.87
55	ygbF-yfp mutant 2	80.6 $\pm$ 2.6	6.2 $\pm$ 0.3	0.085 $\pm$ 0.006	-3.28
56	ygbF-yfp mutant 3	68.5 $\pm$ 3.9	25.4 $\pm$ 1.4	0.413 $\pm$ 0.044	-1.65
57	ygbF-yfp mutant 5	79.0 $\pm$ 4.1	25.1 $\pm$ 0.2	0.352 $\pm$ 0.017	-2.1
58	ygbF-yfp mutant 6	65.3 $\pm$ 2.9	10.8 $\pm$ 0.6	0.183 $\pm$ 0.019	-2.44
59	ygbF-yfp mutant 7	80.5 $\pm$ 4.0	8.3 $\pm$ 0.2	0.113 $\pm$ 0.004	-3.33
60	ygbF-yfp mutant 8	70.4 $\pm$ 3.1	10.8 $\pm$ 0.9	0.170 $\pm$ 0.019	-2.89
61	ygiD-yfp mutant 1	11.0 $\pm$ 1.0	2.1 $\pm$ 0.2	0.216 $\pm$ 0.009	-5.17
62	ygiD-yfp mutant 3	11.3 $\pm$ 0.9	4.2 $\pm$ 0.3	0.417 $\pm$ 0.056	-4.73
63	ygiD-yfp mutant 4	10.6 $\pm$ 0.5	5.4 $\pm$ 0.6	0.572 $\pm$ 0.090	-4.34
64	ygiD-yfp mutant 5	7.2 $\pm$ 1.1	3.3 $\pm$ 0.5	0.514 $\pm$ 0.041	-5.17
65	ygiD-yfp mutant 6	6.8 $\pm$ 1.2	2.7 $\pm$ 0.6	0.476 $\pm$ 0.131	-4.29
66	ygiD-yfp mutant 7	12.3 $\pm$ 2.5	2.7 $\pm$ 0.4	0.251 $\pm$ 0.016	-6.06

Table S5: List of strains

Limiting AA	Strain designation	CGSC number	Genotype
Leu, Arg	CP78	4695	W3110, argH- leuB- thr- his- thi-
Ser	JW2880-1	10234	BW25113, $\Delta serA$
Pro	JW0233-2	8468	BW25113, $\Delta proA$
Ile	JW3745-2	10733	BW25113, $\Delta ilvA$
Gln	JW3841-1	10775	BW25113, $\Delta glnA$
Phe	JW2580-1	10048	BW25113, $\Delta pheA$
-	MG1655	6300	wild-type strain with known genome sequence

Table S6: Concentration of amino acids and methyl esters used for amino acid limitation experiments

Amino Acid	Amino acid concentration in overnight cultures ( $\mu M$ )	Amino acid concentration for amino acid limitation experiments ( $\mu M$ )	Amino acid methyl ester concentration for amino acid limitation experiments ( $\mu M$ )	Catalog number for amino acid methyl ester
Leu	800	100	160	L1002 (Sigma)
Arg	800	150	160	11030 (Sigma)
Ser	10000	5000	800	412201 (Sigma)
Pro	800	0	160	287067 (Sigma)
Ile	800	100	160	I0522 (VWR)
Gln	800	400	400	68604 (Astatech)
Phe	800	50	50	P17202 (Sigma)

Table S7:

w_{i}

values for Leu codons under

{}^{\textrm{GAG}}

Leu2 co-expression

Codon	- log $w_{i}$ (with ${}^{\textrm{GAG}}$ Leu2 co-expression)
CTA	0.48
CTC	0.05
CTG	0.04
CTT	0.02
TTA	0.26
TTG	0.33

Table S8: qPCR primer sequences

Gene	Forward primer	Reverse Primer
yfp	TCATGCTGTTTCATGTGATC	AGGGTGATGCTACTTATGGC
gapA	GCTGAAGGCGAAATGAAAGG	GTACCAGGATACCAGTTTCACG
rpoD	TGAAGCGAACTTACGTCTGG	AGAACTTGTAACCACGGCG
rpoS	TCTCAACATACGCAACCTGG	AGCTTATGGGACAACTCACG
rpoH	TCGTAATTATGCGGGCTATGG	CAGTGAACGGCGAAGGAG
rpoE	CCAGAAGGGAGATCAGAAAGC	TACCACATCGGGAACATCAC
rpoN	TGATCCAACTCTCCCAATTCG	TCGTGATTGGCTAACAGATCG
fecI	ACTACCACAGCTTCCTTAACG	TTTCGCTGACCATTACCCG
fliA	CGCTATGCTGGATGAACTTCG	CTAAACGTTCCGCTACCTCAG
leuA	GTCGCTAACTACAACGGTCG	GCACGCCAGATATTGTTCAG
ilvM	GTTTCCACGTCTGCTCAATG	CTGACTAAACAGTAAGTCGACCG
ilvB	TGAGTTTCCGTGTCCAATCC	ATCTGATGCTGACCAACGTC

Table S9: Codon–tRNA assignments

tRNA	Unmodified Anticodon	Modified Anticodon (if known)	Cognate Codons	Reference
Leu1	CAG	-	CUG	[54]
Leu2	GAG	-	CUC, CUU	[54]
Leu3	UAG	cmo ${}^{\textrm{5}}$ UAG	CUA, CUG, CUU	[16]
Leu4	CAA	CmAA	UUA, UUG	[54, 61]
Leu5	UAA	cmnm ${}^{\textrm{5}}$ UmAA	UUA, UUG	[54, 61]
Arg2	ACG	ICG	CGU, CGC, CGA	[54, 61]
Arg3	CCG	-	CGG	[54]
Arg4	UCU	mnm ${}^{\textrm{5}}$ UCU	AGA, AGG	[9, 61]
Arg5	CCU	-	AGG	[54]
Ser1	UGA	cmo ${}^{\textrm{5}}$ UGA	UCA, UCU, UCG	[54, 61]
Ser2	CGA	-	UCG	[54]
Ser3	GCU	-	AGC, AGU	[54]
Ser5	GGA	-	UCC, UCU	[54]
Pro1	CGG	-	CCG	[54]
Pro2	GGG	-	CCC, CCU	[54]
Pro3	UGG	cmo ${}^{\textrm{5}}$ UGG	CCA, CCU, CCG	[54, 61]
Ile1	GAU	-	AUC, AUU	[54]
Ile2	CAU	k ${}^{\textrm{2}}$ CAU	AUA	[54, 61]
Gln1	UUG	mnm ${}^{\textrm{5}}$ s ${}^{\textrm{2}}$ UUG	CAA, CAG	[54, 61]
Gln2	CUG	-	CAG	[54]
Phe	GAA	-	UUC, UUU	[54]