String Matching with Variable Length Gaps

Abstract

We consider string matching with variable length gaps. Given a string $T$ and a pattern $P$ consisting of strings separated by variable length gaps (arbitrary strings of length in a specified range), the problem is to find all ending positions of substrings in $T$ that match $P$. This problem is a basic primitive in computational biology applications. Let $m$ and $n$ be the lengths of $P$ and $T$, respectively, and let $k$ be the number of strings in $P$. We present a new algorithm achieving time $O(n\log k+m+\alpha)$ and space $O(m+A)$, where $A$ is the sum of the lower bounds of the lengths of the gaps in $P$ and $\alpha$ is the total number of occurrences of the strings in $P$ within $T$. Compared to the previous results this bound essentially achieves the best known time and space complexities simultaneously. Consequently, our algorithm obtains the best known bounds for almost all combinations of $m$, $n$, $k$, $A$, and $\alpha$. Our algorithm is surprisingly simple and straightforward to implement. We also present algorithms for finding and encoding the positions of all strings in $P$ for every match of the pattern.

1 Introduction

Given integers $a$ and $b$, $0\leq a\leq b$, a variable length gap $g\{a,b\}$ is an arbitrary string over $\Sigma$ of length between $a$ and $b$, both inclusive. A variable length gap pattern (abbreviated VLG pattern) $P$ is the concatenation of a sequence of strings and variable length gaps, that is, $P$ is of the form

$$P=P_{1}\cdot g\{a_{1},b_{1}\}\cdot P_{2}\cdot g\{a_{2},b_{2}\}\cdots g\{a_{k-1},b_{k-1}\}\cdot P_{k}\;.$$

A VLG pattern $P$ matches a substring $S$ of $T$ iff $S=P_{1}\cdot G_{1}\cdots G_{k-1}\cdot P_{k}$, where $G_{i}$ is any string of length between $a_{i}$ and $b_{i}$, $i=1,\ldots,k-1$. Given a string $T$ and a VLG pattern $P$, the variable length gap problem (VLG problem) is to find all ending positions of substrings in $T$ that match $P$.

Example 1

As an example, consider the problem instance over the alphabet $\Sigma=\{A,G,C,T\}$:

$$T =\text{ATCGGCTCCAGACCAGTACCCGTTCCGTGGT}$$

$$P =\text{A}\cdot g\{6,7\}\cdot\text{CC}\cdot g\{2,6\}\cdot\text{GT}$$

The solution to the problem instance is the set of positions $\{17,28,31\}$. For example the solution contains 17, since the substring ATCGGCTCCAGACCAGT, ending at position 17 in $T$, matches $P$.

Variable length gaps are frequently used in computational biology applications [16, 14, 17, 7, 8]. For instance, the PROSITE data base [5, 10] supports searching for proteins specified by VLG patterns.

1.1 Previous Work

We briefly review the main worst-case bounds for the VLG problem. As above, let $P=P_{1}\cdot g\{a_{1},b_{1}\}\cdot P_{2}\cdot g\{a_{2},b_{2}\}\cdots g\{a_{k-1},b_{k-1}\}\cdot P_{k}$ be a VLG pattern consisting of $k$ strings, and let $T$ be a string. To state the bounds, let $m=\sum_{i=1}^{k}|P_{i}|$ be the sum of the lengths of the strings in $P$ and let $n$ be the length of $T$.

The simplest approach to solve the VLG problem is to translate $P$ into a regular expression and then use an algorithm for regular expression matching. Unfortunately, the translation produces a regular expression significantly longer than $P$, resulting in an inefficient algorithm. Specifically, suppose that the alphabet $\Sigma$ contains $\sigma$ characters, that is, $\Sigma=\{c_{1},\ldots,c_{\sigma}\}$. Using standard regular expression operators (union and concatenation), we can translate $g\{a,b\}$ into the expression

$$g\{a,b\}=\overbrace{C\cdots C}^{a}\overbrace{(C|\epsilon)\cdots(C|\epsilon)}^{b-a},$$

where $C$ is shorthand for the expression $(c_{1}\mid c_{2}\mid\ldots c_{\sigma})$. Hence, a variable length gap $g\{a,b\}$, represented by a constant length expression in $P$, is translated into a regular expression of length $\Omega(\sigma b)$. Consequently, a regular expression $R$ corresponding to $P$ has length $\Omega(B\sigma+m)$, where $B=\sum_{i=1}^{k-1}b_{i}$ is the sum of the upper bounds of the gaps in $P$. Using Thompson’s textbook regular expression matching algorithm [20] this leads to an algorithm for the VLG problem using $O(n(B\sigma+m))$ time. Even with the fastest known algorithms for regular expression matching this bound can only be improved by at most a polylogarithmic factor [15, 18, 2, 3].

Several algorithms that improve upon the direct translation to a regular expression matching problem have been proposed [16, 14, 6, 17, 12, 13, 19, 7, 8, 4]. Some of these are able to solve more general versions of the problem, such as searching for patterns that also contain character classes and variable length gaps with negative length. Most of the algorithms are based on fast simulations of non-deterministic finite automata. In particular, Navarro and Raffinot [17] gave an algorithm using $O(n(\frac{m+B}{w}+1))$ time, where $w$ is the number of bits in a memory word. Fredrikson and Grabowski [7, 8] improved this bound for the case when all variable length gaps have lower bound $0$ and identical upper bound $b$. Their fastest algorithm achieves $O(n(\frac{m\log\log b}{w}+1))$ time. Very recently, Bille and Thorup [4] gave an algorithm using $O(n(k\frac{\log w}{w}+\log k)+m\log m+A)$ time and $O(m+A)$ space, where $A=\sum_{i=1}^{k-1}a_{i}$ is the sum of the lower bounds on the lengths of the gaps. Note that if we assume that the $nk$ term dominates and ignore the $w/\log w$ factor, the time bound reduces to $O(nk)$.

An alternative approach, suggested independently by Morgante et al. [13] and Rahman et al. [19], is to design algorithms that are efficient in terms of the total number of occurrences of the $k$ strings $P_{1},\ldots,P_{k}$ within $T$. Let $\alpha$ be this number, e.g., in Example 1 A, CC, and GT occur $5$, $5$, and $4$ times in $T$. Hence, $\alpha=5+5+4=14$. Rahman et al. [19] gave an algorithm using $O(n\log k+m+\alpha\log(\max_{1\leq i<k}(b_{i}-a_{i})))$ time. Morgante et al. [13] gave a faster algorithm using $O(n\log k+m+\alpha)$ time. Each of the $k$ strings in $P$ can occur at most $n$ times and therefore $\alpha\leq nk$. Hence, in the typical case when the strings occur less frequently, i.e, $\alpha=o(n(k\frac{\log w}{w}+\log k))$, these approaches are faster. However, unlike the automata based algorithm that only use $O(m+A)$ space, both of these algorithm use $\Theta(m+\alpha)$ space. Since $\alpha$ typically increases with the length of $T$, the space usage of these algorithms is likely to quickly become a bottleneck for processing large biological data bases.

1.2 Our Results

We address the basic question of whether is it possible to design an algorithm that simultaneously is fast in the total number of occurrences of the $k$ strings and uses little space. We show the following result.

Theorem 1

Given a string $T$ and a $VLG$ pattern $P$ with $k$ strings, we can solve the variable length gaps matching problem in time $O(n\log k+m+\alpha)$ and space $O(m+A)$. Here, $\alpha$ is the number of occurrences of the strings of $P$ in $T$ and $A$ is the sum of the lower bounds of the gaps.

Hence, we match the best known time bounds in terms of $\alpha$ and the space for the fastest automata based approach. Consequently, whenever $\alpha=o(n(k\frac{\log w}{w}+\log k))$ the time and space bounds of Theorem 1 are the best known. Our algorithm uses a standard comparison based version of the Aho-Corasick automaton for multi-string matching [1]. If the size of the alphabet is constant or we use hashing the $\log k$ factor in the running time disappears. Furthermore, our algorithm is surprisingly simple and straightforward to implement.

In some cases, we may also be interested in outputting not only the ending positions of matches of $P$, but also the positions of the individual strings in $P$ for each match of $P$ in $T$. Note that there can be exponentially many, i.e., $\Omega(\prod_{i=1}^{k-1}1+b_{i}-a_{i})$, of these occurrences ending at the same position in $T$. Morgante et al. [13] showed how to encode all of these in a graph of size $\Theta(\alpha)$. We show how our algorithm can be extended to efficiently output such a graph. Furthermore, we show two solutions for outputting the positions encoded in the graph. Both solutions use little space since they avoid the need to store the entire graph. The first solution is a black-box solution that works with any algorithm for constructing the graph. The second is a direct approach obtained using a simple extension of our algorithm.

Recently, Haapasalo et al. [9] studied practical algorithms for an extension of the VLG problem that allows multiple patterns and gaps with unbounded upper bounds. We note that the result of Thm. 1 is straightforward to generalize to this case.

1.3 Technical Overview

The previous work by Morgante et al. [13] and Rahman et al. [19] find all of the $\alpha$ occurrences of the strings $P_{1},\ldots,P_{k}$ of $P$ in $T$ using a standard multi-string matching algorithm (see Section 2.1). From these, they construct a graph of size $\Omega(\alpha)$ to represent possible combinations of string occurrences that can be combined to form occurrences of $P$.

Our algorithm similarly finds all of the occurrences of the strings of $P$ in $T$. However, we show how to avoid constructing a large graph representing the possible combinations of occurrences. Instead we present a way to efficiently represent sufficient information to correctly find the occurrences of $P$, leading to a significant space improvement from $O(m+\alpha)$ to $O(m+A)$. Surprisingly, the algorithm needed to achieve this space bound is very simple, and only requires maintaining a set of sorted lists of disjoint intervals. Even though the algorithm is simple the space bound achieved by it is non-obvious. We give a careful analysis leading to the $O(m+A)$ space bound.

Our space-efficient black-box solution for reporting the positions of the individual strings in $P$ for each match of $P$ in $T$ is obtained by constructing the graph for overlapping chunks of $T$ of size $2(m+B)$. Hence the solution is parametrized by the time and space complexity of the actual algorithm used to construct the graph.

2 Algorithm

In this section we present the algorithm. For completeness, we first briefly review the classical Aho-Corasick algorithm for multiple string matching in Section 2.1. We then define the central idea of relevant occurrences in Section 2.2. We present the full algorithm in Section 2.3 and analyze it in Section 3.

2.1 Multi-String Matching

Given a set of pattern strings $\mathcal{P}=\{P_{1},\ldots,P_{k}\}$ of total length $m$ and a text $T$ of length $n$ the multi-string matching problem is to report all occurrences of each pattern string in $T$. Aho and Corasick [1] generalized the classical Knuth-Morris-Pratt algorithm [11] for single string matching to multiple strings. The Aho-Corasick automaton (AC-automaton) for $\mathcal{P}$, denoted $\mathrm{AC}(\mathcal{P})$, consists of the trie of the patterns in $\mathcal{P}$. Hence, any path from the root of the trie to a state $s$ corresponds to a prefix of a pattern in $\mathcal{P}$. We denote this prefix by $\mathrm{path}(s)$. For each state $s$ there is also a special failure transition pointing to the unique state $s^{\prime}$ such that $\mathrm{path}(s^{\prime})$ is the longest prefix of a pattern in $\mathcal{P}$ matching a proper suffix of $\mathrm{path}(s)$. Note that the depth of $s^{\prime}$ in the trie is always strictly smaller for non-root states than the depth of $s$.

Finally, for each state $s$ we store the subset $\mathrm{occ}(s)\subseteq\mathcal{P}$ of patterns that match a suffix of $\mathrm{path}(s)$. Since the patterns in $\mathrm{occ}(s)$ share suffixes we can represent $\mathrm{occ}(s)$ compactly by storing for $s$ the index of the longest string in $\mathrm{occ}(s)$ and a pointer to the state $s^{\prime}$ such that $\mathrm{path}(s^{\prime})$ is the second longest string if any. In this way we can report $\mathrm{occ}(s)$ in $O(|\mathrm{occ}(s)|)$ time.

The maximum outdegree of any state is bounded by the number of leaves in the trie which is at most $k$. Hence, using a standard comparison-based balanced search tree to index the trie transitions out of each state we can construct $\mathrm{AC}(\mathcal{P})$ in $O(m\log k)$ time and $O(m)$ space.

To find the occurrences of $\mathcal{P}$ in $T$, we read the characters of $T$ from left-to-right while traversing $\mathrm{AC}(\mathcal{P})$ to maintain the longest prefix of the strings in $\mathcal{P}$ matching $T$. At a state $s$ and character $c$ we proceed as follows. If $c$ matches the label of a trie transition $t$ from $s$, the next state is the child endpoint of $t$. Otherwise, we recursively follow failure transitions from $s$ until we find a state $s^{\prime}$ with a trie transition $t^{\prime}$ labeled $c$. The next state is then the child endpoint of $t^{\prime}$. If no such state exists, the next state is the root of the trie. For each failure transition traversed in the algorithm we must traverse at least as many trie transitions. Therefore, the total time to traverse $\mathrm{AC}(\mathcal{P})$ and report occurrences is $O(n\log k+\alpha)$, where $\alpha$ is the total number of occurrences.

Hence, the Aho-Corasick algorithm solves multi-string matching in $O((n+m)\log k+\alpha)$ time and $O(m)$ space.

2.2 Relevant Occurrences

For a substring $x$ of $T,$ let $\textrm{\it{startpos}}(x)$ and $\textrm{\it{endpos}}(x)$ denote the start and end position of $x$ in $T$, respectively. Let $x$ be an occurrence of $P_{i}$ with $\tau=\textrm{\it{endpos}}(x)$ in $T$, and let $R(x)$ denote the range $[\tau+a_{i}+1;\tau+b_{i}+1]$ in $T$.

An occurrence $y$ of $P_{i}$ in $T$ is a relevant occurrence of $P_{i}$ iff $i=1$ or $\textrm{\it{startpos}}(y)\in R(x)$, for some relevant occurrence $x$ of $P_{i-1}$. See Fig. 1 for an example. Relevant occurrences are similar to the valid occurrences defined in [19]. The difference is that a valid occurrence is an occurrence of $P_{i+1}$ that is in $R(x)$ for any occurrence $x$ of $P_{i}$ in $T$, i.e., $x$ need not be a valid occurrence itself.

Figure 1: In this figure $x$ is an occurrence of $P_{i}$ in $T$ reported at position $\tau$. The first and last occurrence of $P_{i+1}$ start outside $R(x)$ thereby violating the $i$th gap constraint, so these occurrences are not relevant compared to $x$. The second occurrence $y$ of $P_{i+1}$ starts in $R(x)$, so if $x$ is itself relevant, then $y$ is also relevant.

From the definition of relevant occurrences, it follows directly that we can solve the VLG problem by finding the relevant occurrences of $P_{k}$ in $T$. Specifically, we have the following result.

Lemma 1

Let $S$ be a substring of $T$ matching the VLG pattern $S_{1}\cdot g\{a_{1},b_{1}\}\cdot S_{2}\cdot g\{a_{2},b_{2}\}\cdots S_{k}$. Then, $\textrm{\it{startpos}}(S_{i+1})\in R(S_{i})$ for all $i=1,\ldots,k-1$.

2.3 The Algorithm

Algorithm 1 computes the relevant occurrences of $P_{k}$ using the output from the AC automaton. The idea behind the algorithm is to keep track of the ranges defined by the relevant occurrences of each subpattern $P_{i}$, such that we efficiently can check if an occurrence of $P_{i}$ is relevant or not. More precisely, for each subpattern $P_{i}$, $i=2,\ldots,k$, we maintain a sorted list $L_{i}$ containing the ranges defined by previously reported relevant occurrences of $P_{i-1}$. When an occurrence of $P_{i}$ is reported by the AC automaton, we can determine whether it is relevant by checking if it starts in a range contained in $L_{i}$ (step 2b). Initially, the lists $L_{2},L_{3},\ldots,L_{k}$ are empty. When a relevant occurrence of $P_{i}$ is reported, we add the range defined by this new occurrence to the end of $L_{i+1}$. In case the new range $[s,t]$ overlaps or adjoins the last range $[q,r]$ in $L_{i+1}$ ($s\leq r+1$) we merge the two ranges into a single range $[q,t]$.

Let $\tau$ denote the current position in $T$. A range $[a,b]\in L_{i}$ is dead at position $\tau$ iff $b<\tau-|P_{i}|$. When a range is dead no future occurrences $y$ of $P_{i}$ can start in that range since $\textrm{\it{endpos}}(y)\geq\tau$ implies $\textrm{\it{startpos}}(y)\geq\tau-|P_{i}|$. In Fig. 1 the range $R(x)$ defined by $x$ dies, when position $u$ is reached. Our algorithm repeatedly removes any dead ranges to limit the size of the lists $L_{2},L_{3},\ldots,L_{k}$. To remove the dead ranges in step 2a we traverse the list and delete all dead ranges until we meet a range that is not dead. Since the lists are sorted, all remaining ranges in the list are still alive. See Fig. 2 for an example.

Algorithm 1 Algorithm solving the VLG problem for a VLG pattern $P$ and a string $T$.

1. Build the AC-automaton for the subpatterns $P_{1},P_{2},\ldots,P_{k}$.

2. Process $T$ using the automaton and each time an occurrence $x$ of $P_{i}$ is reported at position $\tau=\textrm{\it{endpos}}(x)$ in $T$ do:

   1. Remove any dead ranges from the lists $L_{i}$ and $L_{i+1}$.

   2. If $i=1$ or $\tau-|P_{i}|=\textrm{\it{startpos}}(x)$ is contained in the first range in $L_{i}$ do:

      1. If $i<k$: Append the range $R(x)=[\tau+a_{i}+1;\tau+b_{i}+1]$ to the end of $L_{i+1}$. If the range overlaps or adjoins the last range in $L_{i+1}$, the two ranges are merged into a single range.

      2. If $i=k$: Report $\tau$.

Figure 2: The occurrences of the subpatterns $P_{1}=\mathrm{A}$, $P_{2}=\mathrm{CC}$ and $P_{3}=\mathrm{GT}$ and the ranges they define in the text $T$ from Example 1. Occurrences which are not relevant are crossed out. The bold occurrences of $P_{3}$ are the relevant occurrences of $P_{k}$ and their end positions 17,28 and 31 constitute the solution to the VLG problem. Consider the point in the execution of the algorithm when the occurrence $x$ of $P_{2}$ at position $\tau=26$ is reported by the Aho-Corasick automaton. At this time $L_{2}=\bigl{[}\;[17;20],[22;23],[25;26]\;\bigl{]}$ and $L_{3}=\bigl{[}\;[23,28]\;\bigl{]}$. The ranges $[17;20]$ and $[22;23]$ are now dead and are removed from $L_{2}$ in step 2a. In step 2b the algorithm determines that $x$ is relevant and $R(x)=[29;33]$ is appended to $L_{3}$: $L_{3}=\bigl{[}\;[23;33]\;\bigl{]}$.

3 Analysis

We now show that Algorithm 1 solves the VLG problem in time $O(n\log k+m+\alpha)$ and space $O(m+A)$, implying Theorem 1.

3.1 Correctness

To show that Algorithm 1 finds exactly the relevant occurrences of $P_{k}$, we show by induction on $i$ that the algorithm in step 2b correctly determines the relevancy of all occurrences of $P_{i}$, $i=1,2,\ldots,k$, in $T$.

Base case:

All occurrences of $P_{1}$ are by definition relevant and Algorithm 1 correctly determines this in step 2b.

Inductive step:

Let $y$ be an occurrence of $P_{i}$, $i>1$, that is reported at position $\tau$. There are two cases to consider.

1. $y$ is relevant. By definition there is a relevant occurrence $x$ of $P_{i-1}$ in $T$, such that $\textrm{\it{startpos}}(y)=\tau-|P_{i}|\in R(x)$. By the induction hypothesis $x$ was correctly determined to be relevant by the algorithm. Since $\textrm{\it{endpos}}(x)<\tau$, $R(x)$ was appended to $L_{i}$ earlier in the execution of the algorithm. It remains to show that the range containing $\textrm{\it{startpos}}(y)$ is the first range in $L_{i}$ in step  2b. When removing the dead ranges in $L_{i}$ in step 2a, all ranges $[a,b]$ where $b<\tau-|P_{i}|$ are removed. Therefore the range containing $\tau-|P_{i}|=\textrm{\it{startpos}}(y)$ is the first range in $L_{i}$ after step 2a. It follows that the algorithm correctly determines that $y$ is relevant.

2. $y$ is not relevant. Then there exists no relevant occurrence $x$ of $P_{i-1}$ such that $\textrm{\it{startpos}}(y)\in R(x)$. By the induction hypothesis there is no range in $L_{i}$ containing $\textrm{\it{startpos}}(y)$, since the algorithm only append ranges when a relevant occurrence is found. Consequently, the algorithm correctly determines that $y$ is not relevant.

3.2 Time and Space Complexity

The AC automaton for the subpatterns $P_{1},P_{2},\ldots,P_{k}$ can be built in time $O(m\log k)$ using $O(m)$ space, where $m=\sum_{i=1}^{k}|P_{i}|$. In the trivial case when $m>n$ we do not need to build the automaton. Hence, we will assume that $m\leq n$ in the following analysis. For each of the $\alpha$ occurrences of the strings $P_{1},P_{2},\ldots,P_{k}$ Algorithm 1 first removes the dead ranges from $L_{i}$ and $L_{i+1}$ and performs a number of constant-time operations. Since both lists are sorted, the dead ranges can be removed by traversing the lists from the beginning. At most $\alpha$ ranges are ever added to the lists, and therefore the algorithm spends $O(\alpha)$ time in total on removing dead ranges. The total time is therefore $O((n+m)\log k+\alpha)=O(n\log k+m+\alpha)$.

To prove the space bound, we first show the following lemma.

Lemma 2

At any time during the execution of the algorithm we have

$$|L_{i}|\leq\left\lfloor\frac{2c_{i-1}+|P_{i}|+a_{i-1}}{c_{i-1}+1}\right\rfloor=O\left(\frac{|P_{i}|+a_{i-1}}{b_{i-1}-a_{i-1}+2}\right),$$

for $i=2,3,\ldots,k$, where $c_{i}=b_{i}-a_{i}+1$.

Proof. Consider list $L_{i}$ for some $i=2,\ldots,k$. Referring to Algorithm 1, the size of the list $L_{i}$ is only increased in step 2(b)i, when a range $R(x_{j})$ defined by a relevant occurrence $x_{j}$ of $P_{i-1}$ is reported and $R(x_{j})$ does not adjoin or overlap the last range in $L_{i}$.

Figure 3: The worst-case situation where $\ell$, the maximum number of ranges are present in $L_{i}$. The figure only shows the first and the last occurrence of $P_{i-1}$ ($x_{1}$ and $x_{\ell}$) defining the $\ell$ ranges.

Let $R(x_{1})=[s,t]$ be the first range in $L_{i}$ at an arbitrary time in the execution of the algorithm. We bound the number of additional ranges that can be added to $L_{i}$ from the time $R(x_{1})$ became the first range in $L_{i}$ until $R(x_{1})$ is removed. The last position where $R(x_{1})$ is still alive is $\tau_{a}=t+|P_{i}|-1$. If a relevant occurrence $x_{\ell}$ of $P_{i-1}$ ends at this position, then the range $R(x_{\ell})=[\tau_{a}+a_{i-1}+1;\tau_{a}+b_{i-1}+1]$ is appended to $L_{i}$. Hence, the maximum number of positions $d$ from $t$ to the end of $R(x_{\ell})$ is

$$d =\tau_{a}+b_{i-1}+1-t$$

$$=(t+|P_{i}|-1)+b_{i-1}+1-t$$

$$=|P_{i}|+b_{i-1}$$

$$=|P_{i}|+a_{i-1}+c_{i-1}-1\enspace.$$

In the worst case, all the ranges in $L_{i}$ are separated by exactly one position as illustrated in Fig. 3. Therefore at most $\lfloor d/(c_{i-1}+1)\rfloor$ additional ranges can be added to $L_{i}$ before $R(x_{1})$ is removed. Counting in $R(x_{1})$ yields the following bound on the size of $L_{i}$

$$|L_{i}|\leq\left\lfloor\frac{d}{c_{i-1}+1}\right\rfloor+1=\left\lfloor\frac{2c_{i-1}+|P_{i}|+a_{i-1}}{c_{i-1}+1}\right\rfloor=O\left(\frac{|P_{i}|+a_{i-1}}{b_{i-1}-a_{i-1}+2}\right)\enspace.$$

$\Box$

By Lemma 2 the total number of ranges stored at any time during the processing of $T$ is at most

$$O\left(\sum_{i=2}^{k}\frac{|P_{i}|+a_{i-1}}{b_{i-1}-a_{i-1}+2}\right)=O\left(\;\sum_{i=1}^{k-1}\frac{|P_{i+1}|}{b_{i}-a_{i}+2}+\sum_{i=1}^{k-1}\frac{a_{i}}{{b_{i}-a_{i}+2}}\right)=O\left(m+A\right)\enspace.$$

Each range can be stored using $O(1)$ space, so this is an upper bound on the space needed to store the lists $L_{2},\ldots,L_{k}$. The AC-automaton uses $O(m)$ space, so the total space required by our algorithm is $O(m+A)$.

In summary, the algorithm uses $O(n\log k+m+\alpha)$ time and $O(m+A)$ space. This completes the proof of Theorem 1.

4 Complete Characterization of Occurrences

In this section we show how our algorithm can be extended to report not only the end position of $P_{k}$, but also the positions of $P_{1},P_{2},\ldots,P_{k-1}$ for each occurrence of $P$ in $T$.

The main idea is to construct a graph that encodes all occurrences of the VLG-pattern using $O(\alpha)$ space. For each occurrence of the VLG-pattern, the positions of the individual subpatterns can be reported by traversing this graph. This approach was also used by Rahman et al. [19] and Morgante et al. [13]. We give a fast new algorithm for constructing this graph and show a black-box solution that can report the occurrences of the VLG-pattern without storing the complete graph.

We introduce the following simple definitions. If $P$ occurs in the text $T$, then a match combination is a sequence $e_{1},\ldots,e_{k}$ of end positions of $P_{1},\ldots,P_{k}$ in $T$ corresponding to the match. The total number of match combinations of $P$ in $T$ is denoted $\beta$. Note that there can be many match combinations corresponding to a single match. See Fig. 4.

Figure 4: The text sequence is the same as in the previous examples. The substring $S$ from position 5 to 17 (highlighted in bold) matches the VLG-pattern $Q=G\cdot g\{0,3\}\cdot C\cdot g\{1,6\}\cdot A\cdot g\{2,7\}\cdot T$. As the figure shows, this match contains the following five match combinations: [5,9,12,17],[5,8,12,17],[5,8,10,17],[5,6,12,17],[5,6,10,17].

Due to the inequality of arithmetic and geometric means, the total number of match combinations $\beta$ is maximized, when the $\alpha$ occurrences are distributed evenly over $P_{1},P_{2},\ldots,P_{k}$ and each occurrence of $P_{i}$ is compatible to all occurrences of $P_{i-1}$ for $i=2,\ldots,k$. So in the worst case $\beta=\Theta\left((\frac{\alpha}{k})^{k}\right)$, which is exponential in the number of gaps. All these match combinations can be encoded in a directed graph using $O(\frac{\alpha^{2}}{k})$ space as follows. The nodes in the graph are the relevant occurrences of $P_{1},P_{2},\ldots,P_{k}$ in $T$. Two nodes $x$ of $P_{i-1}$ and $y$ of $P_{i}$ are connected by an edge from $y$ to $x$ if and only if $startpos(y)\in R(x)$. In that case we also say that $x$ and $y$ are compatible. We denote this graph as the gap graph for $P$ and $T$. See Fig. LABEL:fig:explicitgapgraph. Since the number of nodes in the gap graph is at most $\alpha$, and there are $O\left((\frac{\alpha}{k})^{2}\right)$ edges between the $k$ layers in the worst case, we can store the graph using $O(\frac{\alpha^{2}}{k})$ space.