Asymptotics of Canonical and Saturated RNA Secondary Structures

Abstract

It is a classical result of Stein and Waterman that the asymptotic number of RNA secondary structures is $1.104366\cdot n^{-3/2}\cdot 2.618034^{n}$. In this paper, we study combinatorial asymptotics for two special subclasses of RNA secondary structures – canonical and saturated structures. Canonical secondary structures are defined to have no lonely (isolated) base pairs. This class of secondary structures was introduced by Bompfünewerer et al., who noted that the run time of Vienna RNA Package is substantially reduced when restricting computations to canonical structures. Here we provide an explanation for the speed-up, by proving that the asymptotic number of canonical RNA secondary structures is $2.1614\cdot n^{-3/2}\cdot 1.96798^{n}$ and that the expected number of base pairs in a canonical secondary structure is $0.31724\cdot n$. The asymptotic number of canonical secondary structures was obtained much earlier by Hofacker, Schuster and Stadler using a different method.

Saturated secondary structures have the property that no base pairs can be added without violating the definition of secondary structure (i.e. introducing a pseudoknot or base triple). Here we show that the asymptotic number of saturated structures is $1.07427\cdot n^{-3/2}\cdot 2.35467^{n}$, the asymptotic expected number of base pairs is $0.337361\cdot n$, and the asymptotic number of saturated stem-loop structures is $0.323954\cdot 1.69562^{n}$, in contrast to the number $2^{n-2}$ of (arbitrary) stem-loop structures as classically computed by Stein and Waterman. Finally, we apply work of Drmota [5, 6] to show that the density of states for [all resp. canonical resp. saturated] secondary structures is asymptotically Gaussian. We introduce a stochastic greedy method to sample random saturated structures, called quasi-random saturated structures, and show that the expected number of base pairs of is $0.340633\cdot n$.

1 Introduction

Imagine an undirected graph, described by placing graph vertices $1,\ldots,n$ along the periphery of a circle in a counter-clockwise manner, and placing graph edges as chords within the circle. An outerplanar graph is a graph whose circular representation is planar; i.e. there are no crossings. An RNA secondary structure, formally defined in Section 2, is an outerplanar graph (no pseudoknots) with the property that no vertex is incident to more than one edge (no base triples) and that for every chord between vertices $i,j$, there exist at least $\theta=1$ many vertices that are not incident to any edge (hairpin requirement). RNA secondary structure is equivalently defined to be a well-balanced parenthesis expression $s_{1},\ldots,s_{n}$ with dots, where if nucleotide $i$ is unpaired then $s_{i}=\bullet$, while if there is a base pair between nucleotides $i<j$ then $s_{i}=\,\mbox{\bf{(}}\,$ and $s_{j}=\,\mbox{\bf{)}}\,$. This latter representation is known as the Vienna representation or dot bracket notation (dbn).

Formally, a well-balanced parenthesis expression $w_{1}\cdots w_{n}$ can be defined as follows. If $\Sigma$ denotes a finite alphabet, and $\alpha\in\Sigma$, and $w=w_{1}\cdots w_{n}\in\Sigma^{*}$ is an arbitrary word, or sequence of characters drawn from $\Sigma$, then $|w|_{\alpha}$ designates the number of occurrences of $\alpha$ in $w$. Letting $\Sigma=\{\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,\}$, a word $w=w_{1}\cdots w_{n}\in\Sigma^{*}$ is well-balanced if for all $1\leq i<n$, $|w_{1}\cdots w_{i}|_{\,\mbox{\bf{(}}\,}\geq|w_{1}\cdots w_{i}|_{\,\mbox{\bf{)}}\,}$ and $|w_{1}\cdots w_{n}|_{\,\mbox{\bf{(}}\,}=|w_{1}\cdots w_{n}|_{\,\mbox{\bf{)}}\,}$. Finally, when considering RNA secondary structures, we consider instead the alphabet $\Sigma=\{\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,,\,\mbox{$\bullet$}\,\}$, but otherwise the definition of well-balanced expression remains unchanged. The number of well-balanced parenthesis expressions of length $n$ over the alphabet $\Sigma=\{\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,\}$ is known as the Catalan number $C_{n}$, while that over the alphabet $\Sigma=\{\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,,\,\mbox{$\bullet$}\,\}$ is known as the Motzkin number $M_{n}$ [4]. Stein and Waterman [19] computed the number $S_{n}$ of well-balanced parenthesis expressions in the alphabet $\Sigma=\{\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,,\,\mbox{$\bullet$}\,\}$, where there exist at least $\theta=1$ occurrences of  $\bullet$  between corresponding left and right parentheses  (  respectively  ) . It follows that $S_{n}$ is exactly the number of RNA secondary structures on $[1,n]$, where there exist at least $\theta=1$ unpaired bases in every hairpin loop.

In this paper, we are interested in specific classes of secondary structure: canonical and saturated structures. A secondary structure is canonical [1] if it has no lonely (isolated) base pairs. A secondary structure is saturated [22] if no base pairs can be added without violating the notion of secondary structure, formally defined in Section 2. In order to compute parameters like asymptotic value for number of structures, expected number of base pairs, etc. throughout this paper, we adopt the model of Stein and Waterman [19]. In this model, any position (nucleotide, also known as base) can pair with any other position, and every hairpin loop must contain at least $\theta=1$ unpaired bases; i.e. if $i,j$ are paired, then $j-i>\theta$. This latter condition is due to steric constraints for RNA. At the risk of additional effort, the combinatorial methods of this paper could be applied to handle the situation of most secondary structure software, which set $\theta=3$.

1.1 Examples of secondary structure representations

Figure 1 gives equivalent views of the secondary structure of 5S ribosomal RNA with GenBank accession number NC_000909 of the methane-generating archaebacterium Methanocaldococcus jannaschii, as determined by comparative sequence analysis and taken from the 5S Ribosomal RNA Database [20] located at http://rose.man.poznan.pl/5SData/. The sequence and its secondary structure in (Vienna) dot bracket notation are as follows:

UGGUACGGCGGUCAUAGCGGGGGGGCCACACCCGAACCCAUCCCGAACUCGGAAGUUAAGCCCCCCAGCGAUGCCCCGAGUACUGCCAUCUGGCGGGAAAGGGGCGACGCCGCCGGCCAC
((((.(((((((....(((((((......((((((.............))))..)).....))))).))...(((((.....(((((....)))))....)))))...))))))))))).

Equivalent representations for the same secondary structure may be produced by software jViz [21], as depicted in Figure 1. The left panel of this figure depicts the circular Feynman diagram (i.e. outerplanar graph representation), the middle panel depicts the linear Feynman diagram, and the right panel depicts the classical representation. This latter representation, most familiar to biologists, may also be obtained by RNAplot from the Vienna RNA Package [8].

Figure 1: Depiction of 5S ribosomal RNA from M. Jannaschii with GenBank accession number NC_000909. Equivalent representations as (Left) outerplanar graph (also called Feynman circular diagram), (Middle) Feynman linear diagram, (Right) classical diagram (most familiar to biologists). The sequence and secondary structure were taken from the 5S Ribosomal RNA Database [20], and the graph was created using jViz [21].

1.2 Outline and results of the paper

In Section 2, we review a combinatorial method, known as the DSV methodology and the important Flajolet-Odlyzko Theorem, which allows one to obtain asymptotic values of Taylor coefficients of analytic generating functions $f(z)=\sum_{i=1}^{\infty}a_{i}z^{i}$ by determining the dominant singularity of $f$. The description of the DSV methodology and Flajolet-Odlyzko theorem is not meant to be self-contained, although we very briefly describe the broad outline. For a very clear review of this method, with a number of example applications, please see [12] or the recent monograph of Flajolet and Sedgewick [18].

In Section 2.1, we compute the asymptotic number $2.1614\cdot n^{-3/2}\cdot 1.96798^{n}$ of canonical secondary structures, obtaining the same value obtained by Hofacker, Schuster and Stadler [9] by a different method, known as the Bender-Meir-Moon method. In Section 2.2 we compute the expected number $0.31724\cdot n$ of base pairs in canonical secondary structures. In Section 2.3, we apply the DSV methodology to compute the asymptotic number $1.07427\cdot n^{-3/2}\cdot 2.35467^{n}$ of saturated structures, while in Section 2.4, we compute the expected number $0.337361\cdot n$ of base pairs of saturated structures. In Section 2.5, we compute the asymptotic number $0.323954\cdot 1.69562^{n}$ of saturated stem-loop structures, which is substantially smaller than the number $2^{n-2}-1$ of (all) stem-loop structures, as computed by Stein and Waterman [19].

In Section 3, we consider a natural stochastic process to generate random saturated structures, called in the sequel quasi-random saturated structures. The stochastic process adds base pairs, one at a time, according to the uniform distribution, without violating any of the constraints of a structure. The main result of this section is that asymptotically, the expected number of base pairs in quasi-random saturated structures is $0.340633\cdot n$, rather close to the expected number $0.337361\cdot n$ of base pairs of saturated structures. The numerical proximity of these two values suggests that stochastic greedy methods might find application in other areas of random graph theory. In Section 4 we provide some concluding remarks.

At the web site http://bioinformatics.bc.edu/clotelab/SUPPLEMENTS/JBCBasymptotics/, we have placed Python programs and Mathematica code used in computing and checking the asymptotic number of canonical and saturated secondary structures, as well as the Maple code for checking Drmota’s [6] conditions to deduce the asymptotic normality of the density of states of RNA structures.

2 DSV methodology

In this section, we describe a combinatorial method sometimes called DSV methodology, after Delest, Schützenberger and Viennot, which is a special case of what is called the symbolic method in combinatorics, described at length in [18]. See also the Appendix of [12] for a detailed presentation of this method. This method enables one to obtain information on the number of combinatorial configurations defined by finite rules, for any size. This is done by translating those rules into equations satisfied by various generating functions. A second step is to extract asymptotic expansions from these equations. This is done by studying the singularities of these generating functions viewed as analytic functions.

Since our goal is to derive asymptotic numbers of structures, following standard convention we define an RNA secondary structure on a length $n$ sequence to be a set of ordered pairs $(i,j)$, such that $1\leq i<j\leq n$ and the following are satisfied.

1. Nonexistence of pseudoknots: If $(i,j)$ and $(k,\ell)$ belong to $S$, then it is not the case that $i<k<j<\ell$.

2. No base triples: If $(i,j)$ and $(i,k)$ belong to $S$, then $j=k$; if $(i,j)$ and $(k,j)$ belong to $S$, then $i=k$.

3. Threshold requirement: If $(i,j)$ belongs to $S$, then $j-i>\theta$, where $\theta$, generally taken to be equal to $3$, is the minimum number of unpaired bases in a hairpin loop; i.e. there must be at least $\theta$ unpaired bases in a hairpin loop.

Note that the definition of secondary structure does not mention nucleotide identity – i.e. we do not require base-paired positions $(i,j)$ to be occupied by Watson-Crick or wobble pairs. For this reason, at times we may say that $S$ is a secondary structure on $[1,n]$, rather than saying that $S$ is a structure for RNA sequence of length $n$. In particular, an expression such as “the asymptotic number of structures is $f(n)$” means that the asymptotic number of structures on $[1,n]$ is $f(n)$.

Grammars

We now proceed with basic definitions related to context-free grammars. If $A$ is a finite alphabet, then $A^{*}$ denotes the set of all finite sequences (called words) of characters drawn from $A$. Let $\Sigma$ be the set consisting of the symbols for left parenthesis  ( , right parenthesis  ) , and dot $\bullet$, used to represent a secondary structure in Vienna notation. A context-free grammar (see, e.g., [11]) for RNA secondary structures is given by $G=(V,\Sigma,\mathcal{R},S_{0})$, where $V$ is a finite set of nonterminal symbols (also called variables), $\Sigma=\{\bullet,\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,\}$, $S_{0}\in V$ is the start nonterminal, and

$$\mathcal{R}\subseteq V\times(V\cup\Sigma)^{*}$$

is a finite set of production rules. Elements of $\mathcal{R}$ are usually denoted by $A\rightarrow w$, rather than $(A,w)$. If rules $A\rightarrow\alpha_{1}$,…, $A\rightarrow\alpha_{m}$ all have the same left-hand side, then this is usually abbreviated by $A\rightarrow\alpha_{1}|\cdots|\alpha_{m}$.

If $x,y\in(V\cup\Sigma)^{*}$ and $A\rightarrow w$ is a rule, then by replacing the occurrence of $A$ in $xAy$ we obtain $xwy$. Such a derivation in one step is denoted by $xAy\Rightarrow_{G}xwy$, while the reflexive, transitive closure of $\Rightarrow_{G}$ is denoted $\Rightarrow^{*}_{G}$. The language generated by context-free grammar $G$ is denoted by $L(G)$, and defined by

$$L(G)=\{w\in\Sigma^{*}:S_{0}\Rightarrow^{*}_{G}w\}.$$

For any nonterminal $S\in V$, we also write $L(S)$ to denote the language generated by rules from $G$ when using start symbol $S$. A derivation of word $w$ from start symbol $S_{0}$ using grammar $G$ is a leftmost derivation, if each successive rule application is applied to replace the leftmost nonterminal occurring in the intermediate expression. A context-free grammar $G$ is non-ambiguous, if there is no word $w\in L(G)$ which admits two distinct leftmost derivations. This notion is important since it is only when applied to non-ambiguous grammars that the DSV methodology leads to exact counts.

For the sake of readers unfamiliar with context-free grammars, we present some examples to illustrate the previous concepts. Consider the following grammar $G$, which generates the collection of well-balanced parenthesis strings, including the empty string. Define $G=(V,\Sigma,R,S)$, where the set $V$ of variables (also known as nonterminals) is $\{S\}$, the set $\Sigma$ of terminals is $\{\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,\}$, where $S$ is the start symbol, and where the set $R$ of rules is given by

$$S\rightarrow\epsilon|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|SS$$

Here $\epsilon$ denotes the empty string. We claim that $G$ is an ambiguous grammar. Indeed, consider the following two leftmost derivations, where we denote the order of rule applications $r1:=S\rightarrow\epsilon$, $r2:=S\rightarrow SS$, $r3:=S\rightarrow\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,$, by placing the rule designator under the arrow. Clearly the leftmost derivation

$$S\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r2}}}SS\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r2}}}SSS\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r3,r1}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,SS\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r3,r1}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,S\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r3,r1}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,$$

is distinct from the leftmost derivation

$$S\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r2}}}SS\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r3,r1}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,S\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r2}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,S\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r3,r1}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,S\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r2}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,\stackrel{{\scriptstyle\rightarrow}}{{\mbox{\tiny r1}}}\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,\,\mbox{\bf{(}}\,\,\mbox{\bf{)}}\,$$

yet both generate the same well-balanced parenthesis string. For the same reason, the grammar with rules

$$S\rightarrow\,\mbox{$\bullet$}\,|\,\mbox{$\bullet$}\,S|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|SS$$

generates precisely the collection of non-empty RNA secondary structures, yet this grammar is ambiguous, and we would obtain an overcount by applying the DSV methodology. In contrast, the grammar whose rules are

$$S\rightarrow\,\mbox{$\bullet$}\,|\,\mbox{$\bullet$}\,S|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,S$$

is easily seen to be non-ambiguous and to generate all non-empty RNA secondary structures.

Generating Functions

Suppose that $G=(V,\Sigma,\mathcal{R},S)$ is a non-ambiguous context-free grammar which generates a collection $L(S)$ of objects (e.g. canonical secondary structures). To this grammar is associated a generating function $S(z)=\sum_{n=0}^{\infty}s_{n}z^{n}$, such that the $n$th Taylor coefficient $[z^{n}]S(z)=s_{n}$ represents the number of objects we wish to count. In the sequel, $s_{n}$ will represent the number of canonical secondary structures for RNA sequences of length $n$. The DSV method uses Table 1 in order to translate the grammar rules of $\mathcal{R}$ into a system of equations for the generating functions.

Type of nonterminal	Equation for the g.f.
$S\to T\;|\;U$	$S(z)=T(z)+U(z)$
$S\to T\,U$	$S(z)=T(z)U(z)$
$S\to t$	$S(z)=z$
$S\to\varepsilon$	$S(z)=1$

Table 1: Translation between context-free grammars and generating functions. Here, $G=(V,\Sigma,\mathcal{R},S_{0})$ is a given context-free grammar, $S$, $T$ and $U$ are any nonterminal symbols in $V$, and $t$ is a terminal symbol in $\Sigma$. The generating functions for the languages $L(S)$, $L(T)$, $L(U)$ are respectively denoted by $S(z)$, $T(z)$, $U(z)$.

Asymptotics

In the sequel, we often compute the asymptotic value of the Taylor coefficients of generating functions by first applying the DSV methodology, then using a simple corollary of a result of Flajolet and Odlyzko [7]. That corollary is restated here as the following theorem.

Theorem 1 (Flajolet and Odlyzko)

Assume that $S(z)$ has a singularity at $z=\rho>0$, is analytic in the rest of the region $\triangle\backslash{1}$, depicted in Figure 2, and that as $z\rightarrow\rho$ in $\triangle$,

$$S(z)\sim K(1-z/\rho)^{\alpha}.$$ (1)

Then, as $n\rightarrow\infty$, if $\alpha\notin{0,1,2,...}$,

$$s_{n}\sim\frac{K}{\Gamma(-\alpha)}\cdot n^{-\alpha-1}\rho^{-n}.$$

It is a consequence of Table 1 that the generating series of context-free grammars are algebraic (this is the celebrated theorem of Chomsky and Schützenberger [2]). In particular this implies that they have positive radius of convergence, a finite number of singularities, and their behaviour in the neighborhood of their singularities is of the type (1). (See [18, §VII.6–9] for an extensive treatment.)

A singularity of minimal modulus as in Theorem 1 is called a dominant singularity. The location of the dominant singularity may be a source of difficulty. The simple case is when an explicit expression is obtained for the generating functions; this happens for canonical secondary structures. The situation when only the system of polynomial equations is available is more involved; we show how to deal with it in the case of saturated structures.

Figure 2: The shaded region $\triangle$ where, except at $z=\rho$, the generating function $S(z)$ must be analytic.

2.1 Asymptotic number of canonical secondary structures

In Bompfünewerer et al. [1], the notion of canonical secondary structure $S$ is defined as a secondary structure having no lonely (isolated) base pairs; i.e. formally, there are no base pairs $(i,j)\in S$ for which both $(i-1,j+1)\not\in S$ and $(i+1,j-1)\not\in S$. In this section, we compute the asymptotic number of canonical secondary structures. Throughout this section, secondary structure is interpreted to mean a secondary structure on an RNA sequence of length $n$, for which each base can pair with any other base (not simply Watson-Crick and wobble pairs), and with minimum number $\theta$ of unpaired bases in every hairpin loop set to be $1$. At the cost of working with more complex expressions, by the same method, one could analyze the case when $\theta=3$, which is assumed for the software mfold [23] and RNAfold [8].

Grammar

Consider the context-free grammar $G=(V,\Sigma,{\cal R},S)$, where $V$ consists of nonterminals $S,R$, $\Sigma$ consists of the terminals $\,\mbox{$\bullet$}\,,\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,$, $S$ is the start symbol and $\cal R$ consists of the following rules:

$$S \rightarrow \bullet|S\bullet|\,\mbox{\bf{(}}\,R\,\mbox{\bf{)}}\,|S\,\mbox{\bf{(}}\,R\,\mbox{\bf{)}}\,$$ (2)

$$R \rightarrow \,\mbox{\bf{(}}\,\bullet\,\mbox{\bf{)}}\,|\,\mbox{\bf{(}}\,R\,\mbox{\bf{)}}\,|\,\mbox{\bf{(}}\,S\,\mbox{\bf{(}}\,R\,\mbox{\bf{)}}\,\,\mbox{\bf{)}}\,|\,\mbox{\bf{(}}\,S\bullet\,\mbox{\bf{)}}\,$$

The nonterminal $S$ is intended to generate all nonempty canonical secondary structures. In contrast, the nonterminal $R$ is intended to generate all secondary structures which become canonical when surrounded by a closing set of parentheses. We prove by induction on expression length that the grammar $G$ is non-ambiguous and generates all nonempty canonical secondary structures.

Define context-free grammar $G_{R}$ to consist of the collection $\cal R$ of rules from $G$, defined above, with starting nonterminal $S$, respectively. Formally,

$$G_{R} = (V,\Sigma,{\cal R},R).$$

Let $L(G)$, $L(G_{R})$ denote the languages generated respectively by grammars $G,G_{R}$. Now define languages $L_{1},L_{2}$ of nonempty secondary structures with $\theta=1$ by

$$L_{1} = \{S:\mbox{$S$ is canonical}\}$$

$$L_{2} = \{S:\mbox{$\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,$ is canonical}\}.$$

Note that structures like  $\bullet$  $\bullet$  (  $\bullet$  )  and  (  $\bullet$  )  (  $\bullet$  )  belong to $L_{1}$, but not to $L_{2}$, while structures like  (  (  $\bullet$  )  )  belong to both $L_{1},L_{2}$. Note that any structure $S$ belonging to $L_{2}$ must be of the form $\,\mbox{\bf{(}}\,S_{0}\,\mbox{\bf{)}}\,$; indeed, if $S$ were not of this form, but rather of the form either $\,\mbox{$\bullet$}\,S_{0}$ or $\,\mbox{\bf{(}}\,S_{0}\,\mbox{\bf{)}}\,S_{1}$, then by $\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,$ would have an outermost lonely pair of parentheses.

Claim. $L_{1}=L(G)$, $L_{2}=L(G_{R})$.

Proof of Claim. Clearly $L_{1}\supseteq L(G)$, $L_{2}\supseteq L(G_{R})$, so we show the reverse inclusions by induction; i.e. by induction on $n$, we prove that $L_{1}\cap\Sigma^{n}\subseteq L(G)\cap\Sigma^{n}$, $L_{2}\cap\Sigma^{n}\subseteq L(G_{R})\cap\Sigma^{n}$.

Base case: $n=1$. Clearly $L(G)\cap\Sigma=\{\,\mbox{$\bullet$}\,\}=L_{1}\cap\Sigma$, $L(G_{R})\cap\Sigma=\emptyset=L_{2}\cap\Sigma$.

Induction case: Assume that the claim holds for all $n<k$.

Subcase 1. Let ${\mathcal{S}}$ be a canonical secondary structure with length $|{\mathcal{S}}|=k>1$. Then either (1) ${\mathcal{S}}=\,\mbox{$\bullet$}\,{\mathcal{S}}_{0}$, where ${\mathcal{S}}_{0}\in L_{1}$, or (2) ${\mathcal{S}}=\,\mbox{\bf{(}}\,{\mathcal{S}}_{0}\,\mbox{\bf{)}}\,$, where ${\mathcal{S}}_{0}\in L_{2}$, or (3) ${\mathcal{S}}=\,\mbox{\bf{(}}\,{\mathcal{S}}_{0}\,\mbox{\bf{)}}\,{\mathcal{S}}_{1}$, where ${\mathcal{S}}_{0}\in L_{2}$ and ${\mathcal{S}}_{1}\in L_{1}$. Each of these cases corresponds to a different rule having left side $S$, hence by the induction hypothesis, it follows that ${\mathcal{S}}\in L(G)$.

Subcase 2. Let ${\mathcal{S}}\in L_{2}$ be a secondary structure with length $|S|=k>1$, for which $\,\mbox{\bf{(}}\,{\mathcal{S}}\,\mbox{\bf{)}}\,$ is canonical. If ${\mathcal{S}}$ were of the form $\,\mbox{$\bullet$}\,{\mathcal{S}}_{0}$ or $\,\mbox{\bf{(}}\,{\mathcal{S}}_{0}\,\mbox{\bf{)}}\,{\mathcal{S}}_{1}$, then $\,\mbox{\bf{(}}\,{\mathcal{S}}\,\mbox{\bf{)}}\,$ would not be canonical, since its outermost parenthesis pair would be a lonely pair. Thus ${\mathcal{S}}$ is of the form $\,\mbox{\bf{(}}\,{\mathcal{S}}_{0}\,\mbox{\bf{)}}\,$, where either (1) ${\mathcal{S}}_{0}$ begins with  $\bullet$ , or (2) ${\mathcal{S}}_{0}$ is of the form $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,$, where ${\mathcal{S}}_{1}$ is not canonical, but $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,$ becomes canonical, or (3) ${\mathcal{S}}_{0}$ is of the form $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,$, where ${\mathcal{S}}_{1}$ is canonical and $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,$ is canonical as well.

In case (1), ${\mathcal{S}}_{0}$ is either  $\bullet$  or $\,\mbox{$\bullet$}\,{\mathcal{S}}_{1}$, where ${\mathcal{S}}_{1}$ is canonical. In case (2), ${\mathcal{S}}_{0}$ is of the form $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,$, where ${\mathcal{S}}_{1}$ must have the property that $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,$ is canonical. In case (3), ${\mathcal{S}}_{0}$ is of the form $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,{\mathcal{S}}_{2}$, where it must be that $\,\mbox{\bf{(}}\,{\mathcal{S}}_{1}\,\mbox{\bf{)}}\,$ is canonical and ${\mathcal{S}}_{2}$ is canonical. By applying corresponding rules and the induction hypothesis, it follows that $S\in L(G_{R})$.

It now follows by induction that $L_{1}=L(G)$, $L_{2}=L(G_{R})$. A similar proof by induction shows that the grammar $G$ is non-ambiguous.

Generating Functions

Now, let $s_{n}$ denote the number of canonical secondary structures on a length $n$ RNA sequence. Then $s_{n}$ is the $n$th Taylor coefficient of the generating function $S(z)=\sum_{n\geq 0}s_{n}z^{n}$, denoted by $s_{n}=[z^{n}]S(z)$. Similarly, let $R(z)=\sum_{n\geq 0}R_{n}z^{n}$ be the generating function for the number of secondary structures on $[1,n]$ with $\theta=1$, which become canonical when surrounded by a closing set of parentheses.

By Table 1, the non-ambiguous grammar (2) gives the following equations

$$S(z) = z+S(z)z+R(z)z^{2}+S(z)R(z)z^{2}$$ (3)

$$R(z) = z^{3}+R(z)z^{2}+S(z)R(z)z^{4}+S(z)z^{3}$$ (4)

which can be solved explicitly (solve the second equation for $R$ and inject this in the first equation):

$$S(z)=\frac{1-z-z^{2}+z^{3}-z^{5}-\sqrt{F(z)}}{2z^{4}}$$ (5)

and

$$S(z)=\frac{1-z-z^{2}+z^{3}-z^{5}+\sqrt{F(z)}}{2z^{4}}$$ (6)

where

$$F(z)=4z^{5}\left(-1+z^{2}-z^{4}\right)+\left(-1+z+z^{2}-z^{3}+z^{5}\right)^{2}.$$ (7)

When evaluated at $z=0$, Equation (6) gives $\lim_{r\rightarrow 0}S(z)=\infty$. Since $S(z)$ is known to be analytic at 0, we conclude that $S(z)$ is given by (5).

Location of the dominant singularity

The square root function $\sqrt{z}$ has a singularity at $z=0$, so we are led to investigate the roots of $F(z)$. A numerical computation with Mathematica™ gives the 10 roots $0.508136$, $4.11674$, $-0.868214-0.619448i$, $-0.868214+0.619448i$, $-0.799805-0.367046i$, $-0.799805+0.367046i$, $0.410134-0.564104i$, $0.410134+0.564104i$, $0.945448-0.470929i$, $0.945448+0.470929i$. It follows that $\rho=0.508136$ is the root of $F(z)$ having smallest (complex) modulus.

Asymptotics

Let $T(z)=\frac{1-z-z^{2}+z^{3}-z^{5}}{2z^{4}}$ and factor $1-z/\rho$ out of $F(z)$ to obtain $Q(z)(1-z/\rho)=F(z)$. It follows that

$$S(z)-T(\rho)=\frac{\sqrt{Q(\rho)}}{2\rho^{4}}\cdot(1-z/\rho)^{\alpha}+O(1-z/\rho),\qquad z\rightarrow\rho,$$

where $\alpha=1/2$. This shows that $\rho$ is indeed a dominant singularity for $S$. Note that for each $n\geq 1$, $S(z)$ and $S(z)-T(\rho)$ have the same Taylor coefficient of index $n$, namely $s_{n}$. Now, it is a direct consequence of Theorem 1 that

$$s_{n}\sim\frac{K(\rho)}{\Gamma(-\alpha)}\cdot n^{-\alpha-1}\cdot(1/\rho)^{n},\qquad n\rightarrow\infty$$ (8)

where $\alpha=1/2$ and $K(z)=\frac{\sqrt{Q(z)}}{2z^{4}}$. Plugging $\rho=0.508136$ into equation (8), we derive the following theorem, first obtained by Hofacker, Schuster and Stadler [9] by a different method.

Theorem 2

The asymptotic number of canonical secondary structures on $[1,n]$ is

$$2.1614\cdot n^{-3/2}\cdot 1.96798^{n}.$$ (9)

2.2 Asymptotic expected number of base pairs in canonical structures

In this section, we derive the expected number of base pairs in canonical secondary structures on $[1,n]$.

Generating Functions

The DSV methodology is actually able to produce multivariate generating series. Modifying the equations (3,4) by adding a new variable $u$, intended to count the number of base pairs, we get

$$S(z,u) = z+S(z,u)z+R(z,u)uz^{2}+S(z,u)R(z,u)uz^{2}$$ (10)

$$R(z,u) = uz^{3}+R(z,u)uz^{2}+S(z,u)R(z,u)u^{2}z^{4}+S(z,u)uz^{3}.$$ (11)

This can be solved as before to yield the solution

$$S(z,u) = \sum_{n\geq 0}\sum_{k\geq 0}s_{n,k}z^{n}u^{k}$$

$$= 2u^{2}z^{4}\left(1-z-uz^{2}+uz^{3}-u^{2}z^{5}-\right.$$

$$\left.\sqrt{4u^{2}z^{5}\left(-1+uz^{2}-u^{2}z^{4}\right)+\left(-1+z+uz^{2}-uz^{3}+u^{2}z^{5}\right)^{2}}\right)$$

Here, the coefficient $s_{n,k}$ is the number of canonical secondary structures of size $n$ with $k$ base pairs. Using a classical observation on multivariate generating functions, we recover the expected number of base pairs in a canonical secondary structure on $[1,n]$ using the partial derivative of $S(z,u)$; indeed,

$$\frac{[z^{n}]\frac{\partial S(z,u)}{\partial u}(z,1)}{[z^{n}]S(z,1)} = \frac{[z^{n}]\left(\sum_{i\geq 0}\sum_{k\geq 0}s_{i,k}z^{i}ku^{k-1}\right)(z,1)}{s_{n}}$$

$$= \frac{\sum_{k\geq 0}s_{n,k}k}{s_{n}}=\sum_{k\geq 0}k\frac{s_{n,k}}{s_{n}},$$

and ${s_{n,k}}/{s_{n}}$ is the (uniform) probability that a canonical secondary structure on $[1,n]$ has exactly $k$ base pairs.

We compute that $G(z)=\frac{\partial S(z,u)}{\partial u}(z,1)$ satisfies

$$G(z)=\frac{-(z^{2}-2)(T(z)-\sqrt{F(z)}+z\sqrt{F(z)})}{2z^{4}\sqrt{F(z)}}$$

where $T(z)=(1-2z+2z^{3}-z^{4}-3z^{5}+z^{6})$ and $F(z)$ is as in (7). Simplification yields

$$G(z) = \frac{-(z^{2}-2)(z-1)}{2z^{4}}-\frac{T(z)(z^{2}-2)}{2z^{4}}\cdot\left(\frac{1}{\sqrt{F(z)}}\right).$$

Asymptotics

From this expression, it is clear that the dominant singularity is again located at the same $\rho=0.508136$. A local expansion there gives

$$G(z)\sim K(\rho)(1-z/\rho)^{-1/2},\qquad z\rightarrow\rho$$

with $K(z)=-\frac{Q(z)^{-1/2}T(z)(z^{2}-2)}{2z^{4}}$. By Theorem 1, we obtain the asymptotic value

$$\frac{K(\rho)}{\Gamma(-\alpha)}\cdot n^{-3/2}\cdot(1/\rho)^{n}.$$ (12)

Plugging $\rho=0.508136$ into equation (12), we find the asymptotic value of $[z^{n}]\frac{\partial S(z,u)}{\partial u}(z,1)$ is

$$0.68568\cdot n^{-1/2}\cdot 1.96798^{n}.$$ (13)

Dividing (13) by the asymptotic number $[z^{n}]S(z)$ of canonical secondary structures, given in (9), we have the following theorem.

Theorem 3

The asymptotic expected number of base pairs in canonical secondary structures is $0.31724\cdot n$.

2.3 Asymptotic number of saturated structures

An RNA secondary structure is saturated if it is not possible to add any base pair without violating the definition of secondary structures. If one models the folding of an RNA secondary structure as a random walk on a Markov chain (i.e. by the Metropolis-Hastings algorithm), then saturated structures correspond to kinetic traps with respect to the Nussinov energy model [15]. The asymptotic number of saturated structures was determined in [3] by using a method known as Bender’s Theorem, as rectified by Meir and Moon [14]. In this section, we apply the DSV methodology to obtain the same asymptotic limit, and in the next section we obtain the expected number of base pairs of saturated structures.

Grammar

Consider the context-free grammar with nonterminal symbols $S,R$, terminal symbols $\bullet,\,\mbox{\bf{(}}\,,\,\mbox{\bf{)}}\,$, start symbol $S$ and production rules

$$S \rightarrow \bullet|\bullet\bullet|R\bullet|R\bullet\bullet|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|S\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,$$ (14)

$$R \rightarrow \,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|R\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,$$ (15)

It can be shown by induction on expression length that $L(S)$ is the set of saturated structures, and $L(R)$ is the set of saturated structures with no visible position; i.e. external to every base pair [3]. Here, position $i$ is visible in a secondary structure $T$ if it is external to every base pair of $T$; i.e. for all $(x,y)\in T$, $i<x$ or $i>y$.

Generating Functions

Let

$$S(z)=\sum_{i=0}^{\infty}s_{i}\cdot z^{i},\qquad R(z)=\sum_{i=0}^{\infty}r_{i}\cdot z^{i}$$ (16)

denote the generating functions $S$ resp. $R$, corresponding to the problems of counting number of saturated secondary structures resp. number of saturated structures having no visible positions. Applying Table 1,we are led to the equations

$$S = z+z^{2}+zR+z^{2}R+z^{2}S+z^{2}S^{2}$$ (17)

$$R = z^{2}S+z^{2}RS.$$ (18)

Location of the dominant singularity

By first solving (18) for $R$ and injecting in (17), we get

$$S=z+z^{2}+z^{2}S+z^{2}S^{2}+(z+z^{2})\frac{z^{2}S}{1-z^{2}S},$$ (19)

which upon normalizing gives a polynomial equation of the third degree

$$P(z,S)=-S^{3}z^{4}+z(1+z)-S^{2}z^{2}\left(-2+z^{2}\right)+S\left(-1+z^{2}\right)=0.$$ (20)

Unlike earlier work in this paper, direct solution of this equation by Cardano’s formulas gives expressions that are difficult to handle. Instead, we locate the singularity by appealing to general techniques for implicit generating functions [18, §VII.4].

By the implicit function theorem, singularities of $P(z,S)$ only occur when both $P$ and its partial derivative

$$\frac{\partial P}{\partial S}(z,S)=-1+(1+4S)z^{2}-S(2+3S)z^{4}$$ (21)

vanish simultaneously.

The common roots of $P$ and $\partial P/\partial S$ can be located by eliminating $S$ between those two equations, for instance using the classical theory of resultants (see, e.g., [10]). This gives a polynomial

$$Q(z)=z^{11}(1+z)(4+z-7z^{2}-28z^{3}-32z^{4}+4z^{6}),$$ (22)

that vanishes at all $z$ such that $(z,S)$ is a common root of $P$ and $\partial P/\partial S$.

Numerical computation of the roots of $Q$ yields $0$, $-1$, $-2.29493$, $-0.854537$, $-0.244657-0.5601i$, $-0.244657+0.5601i$, $0.424687$, $3.2141$.

A subtle difficulty now lies in selecting among those points the dominant singularity of the analytic continuation of the solution $S$ of (19) corresponding to the combinatorial problem. Indeed, it is possible that one solution of (19) is singular at a given $r$ without the solution of interest being singular there. Considering such a singularity would result in an asymptotic expansion that is wrong by an exponential factor. One way to select the correct singularity is to apply a result by Meir and Moon [13] to Equation (19). This results in a variant of the computation in [3].

Instead, we use Pringsheim’s theorem (see, e.g., [18]).

Theorem 4 (Pringsheim)

If $S(z)$ has a series expansion at 0 that has nonnegative coefficients and a radius of convergence $R$, then the point $z=R$ is a singularity of $S(z)$.

In our example, there are only two possible real positive singularities, $0.424687$ and $3.2141$. The latter cannot be dominant, since it would lead to asymptotics of the form $3.2141^{-n}$, i.e., an exponentially decreasing number of structures. Thus the dominant singularity is at $\rho=0.424687$. Since the moduli of the non-real roots of $Q$ is $0.611203>\rho$, the conditions of Theorem 1 hold, provided the function behaves as required as $z\rightarrow\rho$.

Asymptotics

We now compute the local expansion of $S(z)$ at $\rho$. From equation (21), we have that

$$P(\rho,S)=0.605047-0.819641S+0.328189S^{2}-0.0325295S^{3}$$ (23)

whose (numerical approximations of) roots are the double root $S=1.6569$ and single root $S=6.77518$. It is easily checked that $1.6569$ is the only root of equation (23) in which $P(\rho,S)$ is increasing; thus we let $T=1.6569$.

Recall Taylor’s theorem in two variables

$$f(x,y)=\sum_{n=0}^{\infty}\sum_{k=0}^{\infty}\frac{\partial^{n+k}f(x_{0},y_{0})}{\partial x^{n}\partial y^{k}}\cdot\frac{(x-x_{0})^{n}}{n!}\cdot\frac{(y-y_{0})^{k}}{k!}.$$

We now expand $P(z,S)$ at $z=\rho$ and $S=T$ and invert this expansion. This yields

$$P(z,S)=P(\rho,T)+\frac{\partial P}{\partial S}(\rho,T)(S-T)+\frac{\partial P}{\partial z}(\rho,T)(z-\rho)+\frac{1}{2}\frac{\partial^{2}P}{\partial S^{2}}(\rho,T)(S-T)^{2}+\cdots$$ (24)

where the dots indicate terms of higher order. The first two terms are $0$, so by denoting $P_{z}=\frac{\partial P}{\partial z}(\rho,T)$ and $P_{SS}=\frac{\partial^{2}P}{\partial S^{2}}(\rho,T)$, we have

$$0=P=P_{z}(z-\rho)+\frac{1}{2}P_{zz}(S-T)^{2}+O(S-T)^{3}+O((z-\rho)(S-T)^{2})+O((z-\rho)^{2}).$$ (25)

Isolating $(S-T)^{2}$ we get

$$(S-T)^{2} = \frac{-2P_{z}(z-\rho)}{P_{SS}}+O((z-\rho)^{2})+O((S-T)^{3})$$

$$S-T = \pm\sqrt{\frac{2\rho P_{z}}{P_{SS}}}\cdot\sqrt{1-z/\rho}+O(z-\rho).$$

Since $[z^{n}]S(z)$ is the number of saturated secondary structures on $[1,n]$ and the Taylor coefficients in the expansion of $\sqrt{1-z/\rho}$ are negative, we discard the positive root and thus obtain

$$S-T=-\sqrt{\frac{2\rho P_{z}}{P_{SS}}}\cdot\sqrt{1-z/\rho}+O(z-\rho).$$ (26)

We now make use of Theorem 1 as before and recover the following result, proved earlier in [3] by the Bender-Meir-Moon method.

Theorem 5

The asymptotic number of saturated structures is $1.07427\cdot n^{-3/2}\cdot 2.35468^{n}$.

2.4 Expected number of base pairs of saturated structures

In this section, we compute the expected number of base pairs of saturated structures, proceeding as in Section 2.2 by first modifying the equations to obtain bivariate generating functions and then differentiating with respect to the new variable and evaluating at 1 to obtain the asymptotic expectation.

Generating Functions

We first modify equations (17,18) by introducing the auxiliary variable $u$, responsible for counting the number of base pairs:

$$S = z+z^{2}+zR+z^{2}R+uz^{2}S+uz^{2}S^{2}$$ (27)

$$R = uz^{2}S+uz^{2}RS.$$ (28)

Solving the second equation for $R$ and injecting into the first one gives

$$P(z,u,S)=Suz^{2}(z+z^{2})-(-1+Suz^{2})(-S+z+z^{2}+Suz^{2}+S^{2}uz^{2}).$$ (29)

Asymptotics

We are interested in the coefficients of $\partial S/\partial u$ at $u=1$. Differentiating (29) with respect to $u$ gives

$$\frac{\partial P}{\partial u}+\frac{\partial P}{\partial S}\frac{\partial S}{\partial u}=0.$$

Using equation (26), we replace $S(z,1)$ by $T+K\sqrt{1-z/\rho}+O(1-z/\rho)$ in this equation to obtain

$$\left(\rho^{2}T(1+2(1-\rho^{2})T-2\rho^{2}T^{2})+O(\sqrt{1-z/\rho})\right)+\\ \left((4K\rho^{2}-2K\rho^{4}-6K\rho^{4}T)\sqrt{1-z/\rho}+O(1-z/\rho)\right)\left.\frac{\partial S}{\partial u}\right|_{u=1}=0$$

and finally

$$\frac{\partial S}{\partial u}\left(z,1\right) \sim -\frac{0.642305}{\sqrt{1-z/\rho}}.$$

Applying Theorem 1 to equation (2.4) gives

$$\rho^{n}[z^{n}]\frac{\partial S}{\partial u}(z,1)\sim\frac{0.642305}{\Gamma(1/2)}\cdot n^{-1/2}=0.362417\cdot n^{-1/2}.$$

It follows that the asymptotic expected number of base pairs in saturated structures on $[1,n]$ is

$$\frac{[z^{n}]\frac{\partial S(z,u)}{\partial u}(z,1)}{[z^{n}]S(z,1)}\sim\frac{0.362417\cdot n^{-1/2}\cdot\rho^{-n}}{1.07427\cdot n^{-3/2}\cdot\rho^{-n}}=0.337361\cdot n$$

We have just proved the following.

Theorem 6

The asymptotic expected number of base pairs for saturated structures is $0.337361\cdot n$.

Since the Taylor coefficient $s_{n,k}$ of generating function $S(z,u)=\sum_{n,k}s_{n,k}z^{n}u^{k}$ is equal to the number of saturated structures having $k$ base pairs, it is possible that the methods of this section will suffice to solve the following open problem.

Open Problem 1

Clearly, the maximum number of base pairs in a saturated structure on $[1,n]$ where $\theta=1$ is $\lfloor\frac{n-1}{2}\rfloor$. For fixed values of $k$, what is the asymptotic number $s_{n,\lfloor(n-1)/2\rfloor-k}$ of saturated secondary structures having exactly $k$ base pairs fewer than the maximum?

Note that in [3], we solved this problem for $k=0,1$.

A related interesting question concerns whether the number of secondary structures $s_{n,k}$ having $k$ base pairs is approximately Gaussian. As first suggested by Y. Ponty (personal communication), this is indeed the case. More formally, consider for fixed $n$ the the finite distribution $\mathbb{P}_{n}=p_{1},\ldots,p_{n}$, where $p_{k}=s_{n,k}/s_{n}$ and $s_{n}=\sum_{k}s_{n,k}$. In the Nussinov energy model, the energy of a secondary structure with $k$ base pairs is $-k$, so the distribution $\mathbb{P}_{n}$ is what is usually called the density of states in physical chemistry. It follows from Theorem 1 of of Drmota [6] (see also [5]) that $\mathbb{P}_{n}$ is Gaussian. Similarly, it follows from Theorem 1 of Drmota that the asymptotic distribution of density of states of both canonical and saturated structures is Gaussian. Details of a Maple session applying Drmota’s theorem to saturated structures appears in the web supplement http://bioinformatics.bc.edu/clotelab/SUPPLEMENTS/JBCBasymptotics/.

2.5 Asymptotic number of saturated stem-loops

Define a stem-loop to be a secondary structure $S$ having a unique base pair $(i_{0},j_{0})\in S$, for which all other base pairs $(i,j)\in S$ satisfy the relation $i<i_{0}<j_{0}<j$. In this case, $(i_{0},j_{0})$ defines a hairpin, and the remaining base pairs, as well as possible internal loops and bulges, constitute the stem. We have the following simple result due to Stein and Waterman [19].

Proposition 1

There are $2^{n-2}-1$ stem-loop structures on $[1,n]$.

Proof.  Let $L(n)$ denote the number of secondary structures with at most one loop on $(1,\ldots,n)$. Then $L(1)=1=L(2)$. There are two cases to consider for $L(n+1)$.

Case 1. If $n+1$ does not form a base pair, then we have a contribution of $L(n)$.

Case 2. $n+1$ forms a base pair with some $1\leq j\leq n-1$. In this case, since only one hairpin loop is allowed, there is no base-pairing for the subsequence $s_{1},\ldots,s_{j-1}$, and hence if $n+1$ base-pairs with $j$, then we have a contribution of $L(n-(j+1)+1)=L(n-j)$. Hence

$$L(n+1) = L(n)+\sum\limits_{j=1}^{n-1}\,L(n-j)$$

$$= L(n)+L(n-1)+\cdots+L(1)$$

and hence $L(1)=1$, $L(2)=1$, $L(3)=2$, and from there $L(n)=2^{n-2}$ by induction.   We now compute the asymptotic number of saturated stem-loop structures. Let $h(n)$ be the number of saturated stem-loops on $[1,n]$, defined by $h(n)=1$ for $n=0,1,2,3$, $h(4)=3$, and

$$h(n)=h(n-2)+2h(n-3)+2h(n-4)$$ (30)

for $n\geq 5$. Note that we have defined $h(1)=1=h(2)$ for notational ease in the sequel, although there are in fact no stem-loops of size $1$ or $2$. Indeed in this case, the only structures of size $1$ respectively $2$ are  $\bullet$  and  $\bullet$  $\bullet$ .

The first few terms in the sequence $h(1),h(2),h(3),\cdots$ are $1$, $1$, $1$, $3$, $5$, $7$, $13$, $23$, $37$, $63$, $109$, $183$, $309$, $527$, $893$, $1511$, $2565$, $4351$, $7373$, $12503$; for instance, $h(20)=12503$.

Grammar

It is easily seen that the following rules

$$S\rightarrow\,\mbox{$\bullet$}\,|\,\mbox{$\bullet$}\,\,\mbox{$\bullet$}\,|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|\,\mbox{$\bullet$}\,\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|\,\mbox{$\bullet$}\,\,\mbox{$\bullet$}\,\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,\,\mbox{$\bullet$}\,|\,\mbox{\bf{(}}\,S\,\mbox{\bf{)}}\,\,\mbox{$\bullet$}\,\,\mbox{$\bullet$}\,$$

provide for a non-ambiguous context-free grammar to generate all non-empty saturated stem-loops. It defines actually a special kind of context-free language, called regular, whose generating function is rational.

Generating Function

By the DSV methodology, we obtain the functional relation

$$R(z)=z+z^{2}+R(z)z^{2}+2R(z)z^{3}+2R(z)z^{4}$$

whose solution is the rational function

$$R(z)=\frac{P(z)}{Q(z)}=\frac{z}{1-z-2z^{3}}$$ (31)

where $P(z)=z$ and $Q(z)=1-z-2z^{3}$.

Asymptotics

For rational functions, an easy way to compute the asymptotic behaviour of the Taylor coefficients is to compute a partial fraction decomposition and isolate the dominant part. This is equivalent to solving the corresponding linear recurrence. See also [17, p. 325] or [16, Thm. 9.2].

Partial fraction decomposition yields

$$R(z)=\frac{A(a_{1})}{1-z/a_{1}}+\frac{A(a_{2})}{1-z/a_{2}}+\frac{A(a_{3})}{1-z/a_{3}},$$

where the $a_{i}$s are the roots of $Q$ and $A(z)=-1/Q^{\prime}(z)$. It follows by extracting coefficients that

$$h(n)=A(a_{1})a_{1}^{-n}+A(a_{2})a_{2}^{-n}+A(a_{3})a_{3}^{-n}.$$

(Note that this is an actual equality valid for all $n\geq 0$ and not an asymptotic result). Now, the roots of $Q$ are approximately

$$a_{1}=0.5897545,\quad a_{2}=-0.294877-0.872272i,\quad a_{3}=-0.294877+0.872272i.$$

Since $|a_{2}|=|a_{3}|=.9207>|a_{1}|$, it follows that the asymptotic behaviour is given by the term in $a_{1}$.

We have proved the following theorem.

Theorem 7

The number $h(n)$ of saturated stem-loops on $[1,n]$ satisfies

$$h(n)\sim 0.323954\cdot 1.69562^{n}.$$ (32)

Convergence of the asymptotic limit in equation (32) is exponentially fast, so that when $n=20$, $0.323954\cdot 1.69562^{n}=12504.2$, while the exact number of saturated stem-loops on $[1,20]$ is $h(20)=12503$.

3 Quasi-random saturated structures

In this section, we define a stochastic greedy process to generate random saturated structures, technically denoted quasi-random saturated structures. Our main result is that the expected number of base pairs in quasi-random saturated structures is $0.0.340633\cdot n$, just slightly more than the expected number $0.337361\cdot n$ of all saturated structures. This suggests that the introduction of stochastic greedy algorithms and their asymptotic analysis may prove useful in other areas of random graph theory.

Consider the following stochastic process to generate a saturated structure. Suppose that $n$ bases are arranged in sequential order on a line. Select the base pair $(1,u)$ by choosing $u$, where $\theta+2\leq u\leq n$, at random with probability $1/(n-\theta-1)$.

Figure 3: Base $1$ is base-paired by selecting a random base $u$ such there are at least $\theta$ unpaired bases enclosed between $1$ and $u$.

The base pair joining $1$ and $u$ partitions the line into two parts. The left region has $k$ bases strictly between $1$ and $u$, where $k\geq\theta$, and the right region contains the remaining $n-k-2$ bases properly contained within endpoints $k+2$ and $n$ (see Figure 3). Proceed recursively on each of the two parts. Observe that the secondary structures produced by our stochastic process will always base pair with the leftmost available base, and that the resulting structure is always saturated.

Before proceeding further, we note that the probability that the probability $p_{i,j}$ that $(i,j)$ is a base pair in a saturated structure is not the same as the probability $q_{i,j}$ that $(i,j)$ is a base pair in a quasi-random saturated structure. Indeed, if we consider saturated and quasi-random saturated structures on an RNA sequence of length $n=10$, then clearly $p_{1,5}=1/29$ while clearly $q_{1,5}=1/8$. Despite the very different base pairing probabilities when comparing saturated with quasi-random saturated structures, it is remarkable that the expected number of base pairs over saturated and quasi-random saturated structures is numerically so close.

Let $U^{\theta}_{n}$ be the expected number of base pairs of the saturated secondary structure generated by this recursive procedure. In general, we have the following recursive equation

$$U^{\theta}_{n} = 1+\frac{1}{n-\theta-1}\sum_{k=\theta}^{n-2}(U^{\theta}_{k}+U^{\theta}_{n-k-2}),\qquad n\geq\theta+2,$$ (33)

with initial conditions

$$U^{\theta}_{0}=U^{\theta}_{1}=\cdots=U^{\theta}_{\theta+1}=0,\quad U^{\theta}_{\theta+2}=U^{\theta}_{\theta+3}=1.$$ (34)

If we write equation (33) for $U^{\theta}_{n+1}$ and substitute in it the value for $U^{\theta}_{n}$ we derive

$$U^{\theta}_{n+1} = 1+\frac{1}{n-\theta}\sum_{k=\theta}^{n-1}(U^{\theta}_{k}+U^{\theta}_{n-k-1})$$

$$= 1+\frac{1}{n-\theta}\left(U^{\theta}_{n-1}+U^{\theta}_{n-\theta-1}+\sum_{k=\theta}^{n-2}(U^{\theta}_{k}+U^{\theta}_{n-k-2})\right)$$

$$= 1+\frac{1}{n-\theta}\left(U^{\theta}_{n-1}+U^{\theta}_{n-\theta-1}\right)+\frac{n-\theta-1}{n-\theta}(U^{\theta}_{n}-1).$$

If we multiply out by $n-\theta$ and simplify we obtain

$$(n-\theta)U^{\theta}_{n+1}=1+(n-\theta-1)U^{\theta}_{n}+U^{\theta}_{n-1}+U^{\theta}_{n-\theta-1},$$ (35)

which is valid for $n\geq\theta+1$.

3.1 Asymptotic behavior

We now look at asymptotics. In particular we prove the following result.

Theorem 8

Let $U_{n}^{\theta}$ denote the expected number of base pairs for quasi-random saturated structures of an RNA sequence of length $n$. Then for fixed $\theta$, and as $n\rightarrow\infty$

$$U_{n}^{\theta}\sim K_{\theta}\cdot n\qquad\text{with}\qquad K_{\theta}=e^{-1-H_{\theta+1}}\int_{0}^{1}{e^{t+(t+t^{2}/2+\dots+t^{\theta+1}/(\theta+1))}\,dt},$$ (36)

where $H_{\theta+1}=1+\frac{1}{2}+\dots+\frac{1}{\theta+1}$ is the $(\theta+1)$th harmonic number.

The first few values can easily be obtained numerically and we have

$$K_{1}=0.340633,\quad K_{2}=0.285497,\quad K_{3}=0.247908,\quad K_{4}=0.220308,\quad K_{5}=0.199018.$$

Proof.  For fixed integer $\theta$, the recurrence (35) is linear with polynomial coefficients. It is a classical result that the generating functions of solutions of such recurrences satisfy linear differential equations. This is obtained by applying the following rules: if $U(z)=\sum_{n\geq 0}u_{n}z^{n}$, then

$$\sum_{n\geq 0}nu_{n}z^{n}=zU^{\prime}(z),\qquad\sum_{n\geq 0}u_{n+k}z^{n}=\frac{1}{z^{k}}(U(z)-u_{0}-u_{1}z-\dots-u_{k-1}z^{k-1}).$$

Starting from (35), we first shift the index by $\theta+1$ and apply these rules together with the initial conditions (34) to get

$$(n+\theta+2)U_{n+\theta+2}^{\theta}-(\theta+1)U_{n+\theta+2}^{\theta} =1+(n+\theta+1)U_{n+\theta+1}^{\theta}-(\theta+1)U_{n+\theta+1}^{\theta}+U_{n+\theta}^{\theta}+U_{n}^{\theta},$$

$$\frac{1}{z^{\theta+2}}zy^{\prime}-(\theta+1)\frac{y}{z^{\theta+2}} =\frac{1}{1-z}+\frac{1}{z^{\theta+1}}zy^{\prime}-(\theta+1)\frac{y}{z^{\theta+1}}+\frac{y}{z^{\theta}}+y.$$

Finally, this simplifies to

$$z(1-z)y^{\prime}+((\theta+1)(z-1)-z^{2}-z^{\theta+2})y=\frac{z^{\theta+2}}{1-z}.$$ (37)

This is a first order non-homogeneous linear differential equation. The homogeneous part

$$z(1-z)W^{\prime}+((\theta+1)(z-1)-z^{2}-z^{\theta+2})W=0$$

is solved by integrating a partial fraction decomposition

$$\frac{W^{\prime}(z)}{W(z)} =\frac{\theta+1}{z}-\frac{z}{z-1}-\frac{z^{\theta+1}}{z-1}$$

$$=\frac{\theta+1}{z}+\frac{2}{z-1}-1-(1+z+\dots+z^{\theta})$$

$$\log W =(\theta+1)\log z-2\log(1-z)-z-(z+z^{2}/2+\dots+z^{\theta+1}/(\theta+1)),$$

$$W(z) =\frac{z^{\theta+1}}{(1-z)^{2}}e^{-z-(z+z^{2}/2+\dots+z^{\theta+1}/(\theta+1))}.$$

From there, variation of the constant gives the following expression for the generating function:

$$y=\frac{z^{\theta+1}}{(1-z)^{2}}e^{-z-(z+z^{2}/2+\dots+z^{\theta+1}/(\theta+1))}\int_{0}^{z}{e^{t+(t+t^{2}/2+\dots+t^{\theta+1}/(\theta+1)}\,dt}.$$

Because the exponential is an entire function, we readily find that the only singularity is at $z=1$, where $y\sim{K}/{(1-z)^{2}}$ with $K$ as in the statement of the theorem. The proof is completed by the use of Theorem 1.  

Note that the asymptotic expected number of base pairs in quasi-random saturated structures with $\theta=1$ is $0.340633\cdot n$, while by Theorem 6 the asymptotic expected number of base pairs in saturated structures is $0.337361\cdot n$, just very slightly less. This result points out that the stochastic greedy method performs reasonably well in sampling saturated structures, although the stochastic process tends not to sample certain (rare) saturated structures having a less than average number of base pairs.

The stochastic process used to construct quasi-random saturated structures iteratively base-pairs the leftmost position in each subinterval. One can imaging a more general stochastic method of constructing saturated structures, described as follows. Generate an initial list $L$ of all allowable base pairs $(i,j)$ with $1\leq i<j\leq n$ and $j\geq i+\theta+1$. Create a saturated structure by repeately picking a base pair from $L$, adding it to an initially empty structure $S$, then removing from $L$ all base pairs that form a crossing (pseudoknot) with the base pair just selected. This ensures that the next time a base pair from $L$, it can be added to $S$ without violating the definition of secondary structure. Iterate this procedure until $L$ is empty to form the stochastic saturated structure $S$.

Taking an average over 100 repetitions, we have computed the average number of base pairs and the standard deviation for $n=10,100,1000$. Results are $\mu=0.323$, $\sigma=0.0604$ for $n=10$, $\mu=0.3526$, $\sigma=0.0386$ for $n=100$ and $\mu=0.35618$, $\sigma=0.0361$ for $n=1000$. This clearly is a different stochastic process than that used for quasi-random saturated structures.

4 Conclusion

In this paper we applied the DSV methodology and the Flajolet-Odlyzko theorem to asymptotic enumeration problems concerning canonical and saturated secondary structures. For instance, we showed that the expected number of base pairs in canonical RNA secondary structures is equal to $0.31724\cdot n$, which is far less than the expected number $0.495917\cdot n$ of base pairs over all secondary structures, the latter which follows from Theorem 4.19 of [9]. This may provide a theoretical explanation for the speed-up observed for Vienna RNA Package when restricted to canonical structures [1].

Additionally, we computed the asymptotic number $1.07427\cdot n^{-3/2}\cdot 2.35467^{n}$ of saturated structures, the expected number $0.337361\cdot n$ of base pairs of saturated structures and the asymptotic number $0.323954\cdot 1.69562^{n}$ of saturated stem-loop structures. We then considered a natural stochastic greedy process to generate quasi-random saturated structures, and showed surprisingly that the expected number of base pairs of is $0.340633\cdot n$, a value very close to the expected number $0.337361\cdot n$ of base pairs of all saturated structures. Finally, we apply a theorem of Drmota [6] to show that the density of states for [all resp. canonical resp. saturated] secondary structures is asymptotically Gaussian.