A class of statistical models to weaken independence in two-way contingency tables

Enrico Carlinilabel=e1]enrico.carlini@polito.it [    Fabio Rapallo label=e2]fabio.rapallo@mfn.unipmn.it [ Politecnico di Torino and University of Eastern Piedmont Department of Mathematics
Politecnico di Torino
Corso Duca degli Abruzzi, 24
10124 TORINO (Italy)

Department of Science and Advanced Technologies
University of Eastern Piedmont
Via Bellini, 25/g
15100 ALESSANDRIA (Italy)
Abstract

In this paper we study a new class of statistical models for contingency tables. We define this class of models through a subset of the binomial equations of the classical independence model. We use some notions from Algebraic Statistics to compute their sufficient statistic, and to prove that they are log-linear. Moreover, we show how to compute maximum likelihood estimates and to perform exact inference through the Diaconis-Sturmfels algorithm. Examples show that these models can be useful in a wide range of applications.

62H17,
60A99, 65C60, 13P10,
Algebraic Statistics,
log-linear models,
Markov bases,
sufficient statistic,
keywords:
[class=AMS]
keywords:
\startlocaldefs\endlocaldefs

and

1 Introduction

One of the most popular statistical models for two-way contingency tables is the independence model. It has became a reference tool in applied research where categorical variables are concerned. In many applications the independence model is sufficient to describe and model the data, but this is not always the case. There are situations where the independence model does not fit the data and one has to detect more complex relations between the random variables. Thus, different models have been introduced in order to identify some structures in the contingency tables. Most of these models belong to the class of log-linear models. Among these, we recall the quasi-independence model, the quasi-symmetry model, the logistic regression model. As a general reference for these models see again agresti:02 . Such models have a wide spectrum of applications in, e.g., biology, psychology and medicine. The books by Fienberg fienberg:80 , Fingleton fingleton:84 , Le le:98 and Agresti agresti:02 present a great deal of examples with real data sets coming from the most disparate disciplines.

A recent development in the area of statistical models for contingency tables involves the use of some tools from Algebraic Geometry to describe the structure and the properties of the models. This field is currently known under the name of Algebraic Statistics. While the first work on this direction relates to a method for exact inference, see diaconis|sturmfels:98 , following papers have focused their attention on the geometry of the statistical models through polynomial algebra. The algebraic and geometric point of view in the analysis of probability models allows us to generalize statistical models in presence of cells with zero probability (toric models), to study its exponential structure, and to make inference feasible also in models with complex structure. This approach has been particularly useful in the fields of log-linear and graphical models. Some relevant works on these recent topics are geiger|meek|sturmfels:06 , garcia|stillman|sturmfels:05 , geiger|heckerman|king|meek:01 , and rapallo:07 . An exposition of such theory, with a view toward applications to computational biology, can be found in patcher|sturmfels:05 .

The theoretical advances mentioned above also have a computational counterpart. In fact, many symbolic softwares traditionally conceived for polynomial algebra now include special functions or packages specifically designed for Algebraic Statistics, see e.g. CoCoA cocoa , 4ti2 4ti2 , and LattE latte .

In this paper we consider statistical models for two-way contingency tables with strictly positive cell probabilities. We introduce a class of models in order to weaken independence, starting from the binomial representation of the independence model. The independence statement means that the table of probabilities has rank 1111, and therefore that all 2×2222\times 22 × 2 minors vanish. In the strictly positive case, this is equivalent to the vanishing of all 2×2222\times 22 × 2 adjacent minors. Our models, which we call weakened independence models, are defined through a subset of the independence binomial equations. As a consequence, the independence statements hold locally and the resulting models allow us to identify local patterns of independence in contingency tables. We study the main properties of such models. In particular, we prove that they belong to the class of log-linear models, and we determine their sufficient statistic. Moreover, we compute the corresponding Markov bases, in order to apply the Diaconis-Sturmfels algorithm without symbolic computations. The relevance of our theory is emphasized by some examples on real data sets. We also show that our models have connections with a problem recently stated by Bernd Sturmfels in the field of probability models for Computational Biology, the so-called “100100100100 Swiss Francs Problem”, see sturmfels:07 .

While most of the papers in Algebraic Statistics uses algebraic and geometric methods to describe and analyze existing statistical models, or to make exact inference, the main focus of this paper is the definition of a new class of models, by exploiting the Algebraic Statistics way of thinking.

Notice that we restrict the analysis to adjacent minors. Therefore, the applications are mainly concerned with binary or ordinal random variables. At the end of the paper we will give some pointers to follow-ups and extensions of this work.

In Section 2 we define the weakened independence models and we give some examples, while in Section 3 we provide the computation of a sufficient statistic. In Section 4 we prove that these models belong to the class of toric models (and therefore they are log-linear for strictly positive probabilities), and we explicitly write down some consequences, such as a canonical parametrization of the models. In Section 5 we compute the Markov bases for weakened independence models and we present some examples with real data. In particular, Example 5.3 is devoted to the discussion of some interesting relationships between our models and the “100100100100 Swiss Francs Problem”. Section 6 highlights the main contributions of our theory and provides some pointers to future developments.

2 Definitions

A two-way contingency table collects data from a sample where two categorical variables, say X𝑋Xitalic_X and Y𝑌Yitalic_Y, are measured. Suppose that X𝑋Xitalic_X has I𝐼Iitalic_I levels and Y𝑌Yitalic_Y has J𝐽Jitalic_J levels. The sample space for a sample of size one is 𝒳={1,,I}×{1,,J}𝒳1𝐼1𝐽{\mathcal{X}}=\{1,\ldots,I\}\times\{1,\ldots,J\}caligraphic_X = { 1 , … , italic_I } × { 1 , … , italic_J } and a joint probability distribution for an I×J𝐼𝐽I\times Jitalic_I × italic_J contingency table is a table of raw probabilities (pi,j)i=1,,I,j=1,,Jsubscriptsubscript𝑝𝑖𝑗formulae-sequence𝑖1𝐼𝑗1𝐽(p_{i,j})_{i=1,\ldots,I,j=1,\ldots,J}( italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT ) start_POSTSUBSCRIPT italic_i = 1 , … , italic_I , italic_j = 1 , … , italic_J end_POSTSUBSCRIPT in the simplex

Δ={(pi,j)i=1,,I,j=1,,J+I×J:i,jpi,j=1}.Δconditional-setsubscriptsubscript𝑝𝑖𝑗formulae-sequence𝑖1𝐼𝑗1𝐽subscriptsuperscript𝐼𝐽subscript𝑖𝑗subscript𝑝𝑖𝑗1\Delta=\left\{(p_{i,j})_{i=1,\ldots,I,j=1,\ldots,J}\in{\mathbb{R}}^{I\times J}_{+}\ :\ \sum_{i,j}p_{i,j}=1\right\}\,.roman_Δ = { ( italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT ) start_POSTSUBSCRIPT italic_i = 1 , … , italic_I , italic_j = 1 , … , italic_J end_POSTSUBSCRIPT ∈ blackboard_R start_POSTSUPERSCRIPT italic_I × italic_J end_POSTSUPERSCRIPT start_POSTSUBSCRIPT + end_POSTSUBSCRIPT : ∑ start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT = 1 } .

A statistical model for an I×J𝐼𝐽I\times Jitalic_I × italic_J contingency table is then a subset of ΔΔ\Deltaroman_Δ defined through equations on the raw probabilities p1,1,,pI,Jsubscript𝑝11subscript𝑝𝐼𝐽p_{1,1},\ldots,p_{I,J}italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT , … , italic_p start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT. In this paper, we do not allow any pi,jsubscript𝑝𝑖𝑗p_{i,j}italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT to be zero, and we assume strict positivity of all probabilities.

The independence model can be defined in parametric form through the power product representation, i.e. by the set of equations

pi,j=ζ0ζiXζjYsubscript𝑝𝑖𝑗subscript𝜁0superscriptsubscript𝜁𝑖𝑋superscriptsubscript𝜁𝑗𝑌p_{i,j}=\zeta_{0}\zeta_{i}^{X}\zeta_{j}^{Y}italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT = italic_ζ start_POSTSUBSCRIPT 0 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_X end_POSTSUPERSCRIPT italic_ζ start_POSTSUBSCRIPT italic_j end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_Y end_POSTSUPERSCRIPT (2.1)

for i=1,,I𝑖1𝐼i=1,\ldots,Iitalic_i = 1 , … , italic_I and j=1,,J𝑗1𝐽j=1,\ldots,Jitalic_j = 1 , … , italic_J, where ζiXsuperscriptsubscript𝜁𝑖𝑋\zeta_{i}^{X}italic_ζ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_X end_POSTSUPERSCRIPT and ζjYsuperscriptsubscript𝜁𝑗𝑌\zeta_{j}^{Y}italic_ζ start_POSTSUBSCRIPT italic_j end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_Y end_POSTSUPERSCRIPT are unrestricted positive parameters and ζ0subscript𝜁0\zeta_{0}italic_ζ start_POSTSUBSCRIPT 0 end_POSTSUBSCRIPT is the normalizing constant, see pistone|riccomagno|wynn:01 . In term of log-probabilities, Eq. (2.1) assumes the most familiar form

logpi,j=λ+λiX+λjYsubscript𝑝𝑖𝑗𝜆superscriptsubscript𝜆𝑖𝑋superscriptsubscript𝜆𝑗𝑌\log p_{i,j}=\lambda+\lambda_{i}^{X}+\lambda_{j}^{Y}roman_log italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT = italic_λ + italic_λ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_X end_POSTSUPERSCRIPT + italic_λ start_POSTSUBSCRIPT italic_j end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_Y end_POSTSUPERSCRIPT (2.2)

where λ=logζ0𝜆subscript𝜁0\lambda=\log\zeta_{0}italic_λ = roman_log italic_ζ start_POSTSUBSCRIPT 0 end_POSTSUBSCRIPT, λiX=logζiXsuperscriptsubscript𝜆𝑖𝑋superscriptsubscript𝜁𝑖𝑋\lambda_{i}^{X}=\log\zeta_{i}^{X}italic_λ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_X end_POSTSUPERSCRIPT = roman_log italic_ζ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_X end_POSTSUPERSCRIPT for i=1,,I𝑖1𝐼i=1,\ldots,Iitalic_i = 1 , … , italic_I and λjY=logζjYsuperscriptsubscript𝜆𝑗𝑌superscriptsubscript𝜁𝑗𝑌\lambda_{j}^{Y}=\log\zeta_{j}^{Y}italic_λ start_POSTSUBSCRIPT italic_j end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_Y end_POSTSUPERSCRIPT = roman_log italic_ζ start_POSTSUBSCRIPT italic_j end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_Y end_POSTSUPERSCRIPT for j=1,J𝑗1𝐽j=1,\ldots Jitalic_j = 1 , … italic_J. As an equivalent representation, one can derive implicit formulae on the raw probabilities pi,jsubscript𝑝𝑖𝑗p_{i,j}italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT. Eliminating the ζ𝜁\zetaitalic_ζ variables from Eq. (2.1), one obtains the set of equations below:

pi,jpk,mpi,mpk,j=0subscript𝑝𝑖𝑗subscript𝑝𝑘𝑚subscript𝑝𝑖𝑚subscript𝑝𝑘𝑗0p_{i,j}p_{k,m}-p_{i,m}p_{k,j}=0italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_k , italic_m end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT italic_i , italic_m end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_k , italic_j end_POSTSUBSCRIPT = 0 (2.3)

for all 1i<kI1𝑖𝑘𝐼1\leq i<k\leq I1 ≤ italic_i < italic_k ≤ italic_I and 1j<mJ1𝑗𝑚𝐽1\leq j<m\leq J1 ≤ italic_j < italic_m ≤ italic_J. In other words, in the independence model all 2×2222\times 22 × 2 minors of the table vanish. It is well known, see e.g. agresti:02 , that in the positive case, the equalities in Eq. (2.3) are redundant and it is enough to set to zero the adjacent minors:

pi,jpi+1,j+1pi+1,jpi,j+1subscript𝑝𝑖𝑗subscript𝑝𝑖1𝑗1subscript𝑝𝑖1𝑗subscript𝑝𝑖𝑗1p_{i,j}p_{i+1,j+1}-p_{i+1,j}p_{i,j+1}italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j + 1 end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i , italic_j + 1 end_POSTSUBSCRIPT (2.4)

for all 1i<I1𝑖𝐼1\leq i<I1 ≤ italic_i < italic_I and 1j<J1𝑗𝐽1\leq j<J1 ≤ italic_j < italic_J.

Remark 2.1.

In the framework of toric models as defined in pistone|riccomagno|wynn:01 , where structural zeros are allowed, the implicit representations (2.3) and (2.4) are not equivalent, as they differ on the boundary. For a description of such phenomenon, see rapallo:07 .

In algebraic terms, let

𝒞={pi,jpi+1,j+1pi+1,jpi,j+1: 1i<I, 1j<J}.𝒞conditional-setsubscript𝑝𝑖𝑗subscript𝑝𝑖1𝑗1subscript𝑝𝑖1𝑗subscript𝑝𝑖𝑗1formulae-sequence1𝑖𝐼1𝑗𝐽{\mathcal{C}}=\{p_{i,j}p_{i+1,j+1}-p_{i+1,j}p_{i,j+1}\ :\ 1\leq i<I,\ 1\leq j<J\}\,.caligraphic_C = { italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j + 1 end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i , italic_j + 1 end_POSTSUBSCRIPT : 1 ≤ italic_i < italic_I , 1 ≤ italic_j < italic_J } .

The set 𝒞𝒞{\mathcal{C}}caligraphic_C is the set of all 2×2222\times 22 × 2 adjacent minors of the table of probabilities. Moreover, let [p]delimited-[]𝑝{\mathbb{R}}[p]blackboard_R [ italic_p ] be the polynomial ring in I×J𝐼𝐽I\times Jitalic_I × italic_J indeterminates with real coefficients.

From the geometric point of view, the independence model is the variety

V𝒞={pi,j:𝒞=0}Δ,subscript𝑉𝒞conditional-setsubscript𝑝𝑖𝑗𝒞0ΔV_{\mathcal{C}}=\{p_{i,j}\ :\ {\mathcal{C}}=0\}\cap\Delta\,,italic_V start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT = { italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT : caligraphic_C = 0 } ∩ roman_Δ ,

i.e., the set of the points of the simplex where all binomials in 𝒞𝒞{\mathcal{C}}caligraphic_C vanish.

The choice of a subset of 𝒞𝒞{\mathcal{C}}caligraphic_C leads us to the definition of a new class of models.

Definition 2.2.

Let {\mathcal{B}}caligraphic_B be a subset of 𝒞𝒞{\mathcal{C}}caligraphic_C. The {\mathcal{B}}caligraphic_B-weakened independence model is the variety

V={pi,j:=0}Δ.subscript𝑉conditional-setsubscript𝑝𝑖𝑗0ΔV_{\mathcal{B}}=\{p_{i,j}\ :\ {\mathcal{B}}=0\}\cap\Delta\,.italic_V start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT = { italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT : caligraphic_B = 0 } ∩ roman_Δ .

Of course, V𝒞Vsubscript𝑉𝒞subscript𝑉V_{\mathcal{C}}\subseteq V_{\mathcal{B}}italic_V start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT ⊆ italic_V start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT for all subsets {\mathcal{B}}caligraphic_B of 𝒞𝒞{\mathcal{C}}caligraphic_C. The meaning of the class of models in Definition 2.2 is quite simple. In fact, the choice of a given set of minors means that we allow the binomial independence statements to hold locally, i.e., we determine patterns of independence.

Example 2.3.

As a first applications, we consider a 2×J2𝐽2\times J2 × italic_J contingency table. A table of this kind could derive, e.g., from the observation of a binary random variable X𝑋Xitalic_X at different times.

The model defined through the set of binomials

={p1,1p2,2p1,2p2,1,p1,2p2,3p1,3p2,2,,p1,j1p2,jp1,jp2,j1},subscript𝑝11subscript𝑝22subscript𝑝12subscript𝑝21subscript𝑝12subscript𝑝23subscript𝑝13subscript𝑝22subscript𝑝1superscript𝑗1subscript𝑝2superscript𝑗subscript𝑝1superscript𝑗subscript𝑝2superscript𝑗1{\mathcal{B}}=\{p_{1,1}p_{2,2}-p_{1,2}p_{2,1},p_{1,2}p_{2,3}-p_{1,3}p_{2,2},\ldots,p_{1,j^{\prime}-1}p_{2,j^{\prime}}-p_{1,j^{\prime}}p_{2,j^{\prime}-1}\}\,,caligraphic_B = { italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , 2 end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT 1 , 2 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , 1 end_POSTSUBSCRIPT , italic_p start_POSTSUBSCRIPT 1 , 2 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , 3 end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT 1 , 3 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , 2 end_POSTSUBSCRIPT , … , italic_p start_POSTSUBSCRIPT 1 , italic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT - 1 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , italic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT 1 , italic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , italic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT - 1 end_POSTSUBSCRIPT } ,

where j<Jsuperscript𝑗𝐽j^{\prime}<Jitalic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT < italic_J, is presented in Figure 1. This choice of {\mathcal{B}}caligraphic_B means that there is independence between X𝑋Xitalic_X and the time up to the instant jsuperscript𝑗j^{\prime}italic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT and not after.

1111

2222

3333

\ldots
\ldots


jsuperscript𝑗j^{\prime}italic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT



\ldots
\ldots

J𝐽Jitalic_J
Figure 1: Binomials for a change-point problem in logistic regression.

In literature, the point jsuperscript𝑗j^{\prime}italic_j start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT in this model refers to the detection of the change-point in a logistic regression model. A recent paper about this topic is gurevich|vexler:05 .

Example 2.4.

Let us consider a I×I𝐼𝐼I\times Iitalic_I × italic_I contingency table. A table of this kind could derive from a rater agreement analysis. Suppose that 2222 raters independently classify n𝑛nitalic_n objects using a nominal or ordinal scale with I𝐼Iitalic_I categories. If we set

={p1,1p2,2p1,2p2,1}subscript𝑝11subscript𝑝22subscript𝑝12subscript𝑝21{\mathcal{B}}=\{p_{1,1}p_{2,2}-p_{1,2}p_{2,1}\}caligraphic_B = { italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , 2 end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT 1 , 2 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT 2 , 1 end_POSTSUBSCRIPT }

the corresponding model yields that categories 1111 and 2222 are indistinguishable. A reference for the notion of category indistinguishability is, e.g., darroch|mccloud:86 . This model can be generalized using the set of binomials

={pi,jpi+1,j+1pi,j+1pi+1,j: 1ii, 1ji}conditional-setsubscript𝑝𝑖𝑗subscript𝑝𝑖1𝑗1subscript𝑝𝑖𝑗1subscript𝑝𝑖1𝑗formulae-sequence1𝑖superscript𝑖1𝑗superscript𝑖{\mathcal{B}}=\{p_{i,j}p_{i+1,j+1}-p_{i,j+1}p_{i+1,j}\ :\ 1\leq i\leq i^{\prime},\ 1\leq j\leq i^{\prime}\}caligraphic_B = { italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j + 1 end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT italic_i , italic_j + 1 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j end_POSTSUBSCRIPT : 1 ≤ italic_i ≤ italic_i start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT , 1 ≤ italic_j ≤ italic_i start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT }

meaning that the categories 1,,i1superscript𝑖1,\ldots,i^{\prime}1 , … , italic_i start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT are indistinguishable. The first paper in the direction of modelling patterns of agreement is agresti:92 . An example with 5555 categories and 3333 undistinguishable categories is presented in Figure 2.

























Figure 2: Binomials for Example 2.4.

More examples on the models for rater agreement problems will be presented later in the paper.

Remark 2.5.

In the next sections, our approach will proceed somehow backwards with respect to the classical log-linear models theory. In fact, we will define the model through the binomials and then we will use them to determine a sufficient statistic and a parametrization.

3 Sufficient statistic

As noticed in the Introduction, the independence model is defined through the log-linear form in Eq. (2.2). One can easily check that for the independence model a sufficient statistic T𝑇Titalic_T for the sample of size 1111 is given by the indicator functions of the I𝐼Iitalic_I rows and the indicator functions of the J𝐽Jitalic_J columns. More precisely, we denote the indicator function of the i𝑖iitalic_i-th row by 𝕀(i,+)subscript𝕀𝑖{\mathbb{I}}_{(i,+)}blackboard_I start_POSTSUBSCRIPT ( italic_i , + ) end_POSTSUBSCRIPT and the indicator function of the j𝑗jitalic_j-th column by 𝕀(+,j)subscript𝕀𝑗{\mathbb{I}}_{(+,j)}blackboard_I start_POSTSUBSCRIPT ( + , italic_j ) end_POSTSUBSCRIPT. Writing the sample space as 𝒳={1,,I}×{1,,J}𝒳1𝐼1𝐽{\mathcal{X}}=\{1,\ldots,I\}\times\{1,\ldots,J\}caligraphic_X = { 1 , … , italic_I } × { 1 , … , italic_J }, a sufficient statistic for the independence model is

T=(𝕀(1,+),,𝕀(I,+),𝕀(+,1),,𝕀(+,J)).𝑇subscript𝕀1subscript𝕀𝐼subscript𝕀1subscript𝕀𝐽T=\left({\mathbb{I}}_{(1,+)},\ldots,{\mathbb{I}}_{(I,+)},{\mathbb{I}}_{(+,1)},\ldots,{\mathbb{I}}_{(+,J)}\right)\,.italic_T = ( blackboard_I start_POSTSUBSCRIPT ( 1 , + ) end_POSTSUBSCRIPT , … , blackboard_I start_POSTSUBSCRIPT ( italic_I , + ) end_POSTSUBSCRIPT , blackboard_I start_POSTSUBSCRIPT ( + , 1 ) end_POSTSUBSCRIPT , … , blackboard_I start_POSTSUBSCRIPT ( + , italic_J ) end_POSTSUBSCRIPT ) .

A single observation is an element of the sample space 𝒳𝒳{\mathcal{X}}caligraphic_X and its table has a single count of 1111 in one cell and 00 otherwise. This observation yields a value of 1111 in the corresponding row and column indicator functions in T𝑇Titalic_T.

Therefore, the sufficient statistic T𝑇Titalic_T for a sample of size 1111 is a linear map from 𝒳𝒳{\mathcal{X}}caligraphic_X to I+Jsuperscript𝐼𝐽{\mathbb{N}}^{I+J}blackboard_N start_POSTSUPERSCRIPT italic_I + italic_J end_POSTSUPERSCRIPT. The function T𝑇Titalic_T can be extended to a linear homomorphism T:IJI+J:𝑇superscript𝐼𝐽superscript𝐼𝐽T:{\mathbb{R}}^{IJ}\rightarrow{\mathbb{R}}^{I+J}italic_T : blackboard_R start_POSTSUPERSCRIPT italic_I italic_J end_POSTSUPERSCRIPT → blackboard_R start_POSTSUPERSCRIPT italic_I + italic_J end_POSTSUPERSCRIPT.

In Section 4 we will prove that weakened independence models, as the independence model, are log-linear. Thus, the sufficient statistic for a sample of size n𝑛nitalic_n is the sum of the sufficient statistics of all components of the sample and it will be formed by the sum of appropriate cell counts, as familiar in the field of categorical data analysis, see e.g. agresti:02 . However, in this section it is more convenient to work with a sample of size one and with the indicator functions. This approach has been fruitfully used in haberman:74 and, more recently, in pistone|riccomagno|wynn:01 .

Hereinafter, we write the table as a column vector, i.e. the table of probabilities is written as

p=(p1,1,,p1,J,,pI,1,,pI,J)t,𝑝superscriptsubscript𝑝11subscript𝑝1𝐽subscript𝑝𝐼1subscript𝑝𝐼𝐽𝑡p=\left(p_{1,1},\ldots,p_{1,J},\ldots,p_{I,1},\ldots,p_{I,J}\right)^{t}\,,italic_p = ( italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT , … , italic_p start_POSTSUBSCRIPT 1 , italic_J end_POSTSUBSCRIPT , … , italic_p start_POSTSUBSCRIPT italic_I , 1 end_POSTSUBSCRIPT , … , italic_p start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT ) start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT ,

where t𝑡titalic_t denotes the transposition. Moreover, we use a vector notation, i.e. we write a binomial in the form papbsuperscript𝑝𝑎superscript𝑝𝑏p^{a}-p^{b}italic_p start_POSTSUPERSCRIPT italic_a end_POSTSUPERSCRIPT - italic_p start_POSTSUPERSCRIPT italic_b end_POSTSUPERSCRIPT, meaning p1,1a1,1pI,JaI,Jp1,1b1,1pI,JbI,Jsuperscriptsubscript𝑝11subscript𝑎11superscriptsubscript𝑝𝐼𝐽subscript𝑎𝐼𝐽superscriptsubscript𝑝11subscript𝑏11superscriptsubscript𝑝𝐼𝐽subscript𝑏𝐼𝐽p_{1,1}^{a_{1,1}}\cdots p_{I,J}^{a_{I,J}}-p_{1,1}^{b_{1,1}}\cdots p_{I,J}^{b_{I,J}}italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_a start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT end_POSTSUPERSCRIPT ⋯ italic_p start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_a start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT end_POSTSUPERSCRIPT - italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_b start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT end_POSTSUPERSCRIPT ⋯ italic_p start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_b start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT end_POSTSUPERSCRIPT.

We briefly review the relationship between the sufficient statistic and the binomials in Eq. (2.4). Writing the table as a column vector of length IJ𝐼𝐽IJitalic_I italic_J, the matrix representation of T𝑇Titalic_T is a matrix A𝒞subscript𝐴𝒞A_{\mathcal{C}}italic_A start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT. This matrix has size IJ×(I+J)𝐼𝐽𝐼𝐽IJ\times(I+J)italic_I italic_J × ( italic_I + italic_J ) and its rank is I+J1𝐼𝐽1I+J-1italic_I + italic_J - 1.

Moreover, consider the log-vector of a 2×2222\times 22 × 2 minor to be defined in the following way:

Λ::Λabsent\displaystyle\Lambda:roman_Λ : [p]delimited-[]𝑝\displaystyle{\mathbb{R}}[p]blackboard_R [ italic_p ] IJabsentsuperscript𝐼𝐽\displaystyle\longrightarrow{\mathbb{R}}^{IJ}⟶ blackboard_R start_POSTSUPERSCRIPT italic_I italic_J end_POSTSUPERSCRIPT
papbsuperscript𝑝𝑎superscript𝑝𝑏\displaystyle p^{a}-p^{b}italic_p start_POSTSUPERSCRIPT italic_a end_POSTSUPERSCRIPT - italic_p start_POSTSUPERSCRIPT italic_b end_POSTSUPERSCRIPT ababsent𝑎𝑏\displaystyle\longmapsto a-b⟼ italic_a - italic_b

We denote by Z𝒞subscript𝑍𝒞Z_{\mathcal{C}}italic_Z start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT the sub-vector space of IJsuperscript𝐼𝐽{\mathbb{R}}^{IJ}blackboard_R start_POSTSUPERSCRIPT italic_I italic_J end_POSTSUPERSCRIPT generated by the vectors Λ(m)Λ𝑚\Lambda(m)roman_Λ ( italic_m ), for all 2×2222\times 22 × 2 adjacent minors m𝑚mitalic_m. It is well known, see for example bishop|fienberg|holland:75 , that Z𝒞subscript𝑍𝒞Z_{\mathcal{C}}italic_Z start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT has dimension (I1)(J1)𝐼1𝐽1(I-1)(J-1)( italic_I - 1 ) ( italic_J - 1 ) and the sequence of log-vectors Λ(m)Λ𝑚\Lambda(m)roman_Λ ( italic_m ) with m𝒞𝑚𝒞m\in{\mathcal{C}}italic_m ∈ caligraphic_C is a sequence of (I1)(J1)𝐼1𝐽1(I-1)(J-1)( italic_I - 1 ) ( italic_J - 1 ) linearly independent vectors orthogonal to A𝒞subscript𝐴𝒞A_{\mathcal{C}}italic_A start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT. Hence the column space A𝒞subscript𝐴𝒞A_{\mathcal{C}}italic_A start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT is the orthogonal of Z𝒞subscript𝑍𝒞Z_{\mathcal{C}}italic_Z start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT Thus, from a vector-space perspective, the exponents of the binomials are the orthogonal complement of the matrix A𝒞subscript𝐴𝒞A_{\mathcal{C}}italic_A start_POSTSUBSCRIPT caligraphic_C end_POSTSUBSCRIPT. In the sequel, we will use the same symbol to denote a matrix A𝐴Aitalic_A and the sub-vector space of IJsuperscript𝐼𝐽{\mathbb{R}}^{IJ}blackboard_R start_POSTSUPERSCRIPT italic_I italic_J end_POSTSUPERSCRIPT generated by the columns of A𝐴Aitalic_A, although this should be considered as a slight abuse of notation.

The procedure described above is quite general and it provides a method to actually compute the relevant binomials of a statistical model with a given sufficient statistic. For more details, see pistone|riccomagno|wynn:01 .

In order to analyze the weakened independence models in Definition 2.2, we use the theory sketched above for the independence model. We start with a set of binomials, we compute a sufficient statistic and the parametric representation of the model.

Remark 3.1.

We will prove in Section 4 that weakened independence models are log-linear. Therefore, the orthogonal to the log-vectors of the chosen binomials is the matrix representation of a sufficient statistic. In order to keep notation as simple as possible, we call this orthogonal a sufficient statistic even before showing that the models are log-linear.

Lemma 3.2.

The log-vectors of d𝑑ditalic_d distinct adjacent minors are linearly independent.

Proof.

Let dsubscript𝑑{\mathcal{B}}_{d}caligraphic_B start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT be a set of d𝑑ditalic_d distinct adjacent minors and let Ldsubscript𝐿𝑑L_{d}italic_L start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT be the set of their log-vectors. We proceed by induction on d𝑑ditalic_d. For d=1𝑑1d=1italic_d = 1 the statement is clearly true. We assume that the elements of Lisubscript𝐿𝑖L_{i}italic_L start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT are linearly independent for all i<d𝑖𝑑i<ditalic_i < italic_d and we will show that the same holds for Ldsubscript𝐿𝑑L_{d}italic_L start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT. Let md𝑚subscript𝑑m\in{\mathcal{B}}_{d}italic_m ∈ caligraphic_B start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT be the minor involving the indeterminate having the lex-smallest index, say pi¯,j¯subscript𝑝¯𝑖¯𝑗p_{\bar{i},\bar{j}}italic_p start_POSTSUBSCRIPT over¯ start_ARG italic_i end_ARG , over¯ start_ARG italic_j end_ARG end_POSTSUBSCRIPT, and notice that no other element in dsubscript𝑑{\mathcal{B}}_{d}caligraphic_B start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT involves pi¯,j¯subscript𝑝¯𝑖¯𝑗p_{\bar{i},\bar{j}}italic_p start_POSTSUBSCRIPT over¯ start_ARG italic_i end_ARG , over¯ start_ARG italic_j end_ARG end_POSTSUBSCRIPT. Let l=Λ(m)Ld𝑙Λ𝑚subscript𝐿𝑑l=\Lambda(m)\in L_{d}italic_l = roman_Λ ( italic_m ) ∈ italic_L start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT and notice that l𝑙litalic_l is not a linear combination of the element of Ld{l}subscript𝐿𝑑𝑙L_{d}\setminus\{l\}italic_L start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT ∖ { italic_l } which are linearly independent by hypothesis. Hence the element of Ldsubscript𝐿𝑑L_{d}italic_L start_POSTSUBSCRIPT italic_d end_POSTSUBSCRIPT are linearly independent. ∎

Remark 3.3.

Lemma 3.2 is false when we consider log-vectors of non-adjacent minors. As a counterexample, take a 2×3232\times 32 × 3 table and all three minors.

Now, consider a {\mathcal{B}}caligraphic_B-weakened independence model with set of adjacent minors {\mathcal{B}}caligraphic_B of cardinality m𝑚mitalic_m. Let Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT be the matrix of the log-vectors of the adjacent minors in {\mathcal{B}}caligraphic_B. In view of Lemma 3.2, the orthogonal of Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT has dimension (IJm)𝐼𝐽𝑚(IJ-m)( italic_I italic_J - italic_m ). Thus, the explicit computation of Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, the orthogonal of Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, requires to find at least (IJm)𝐼𝐽𝑚(IJ-m)( italic_I italic_J - italic_m ) vectors orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. Although this can be done simply with a linear algebra algorithm, it is very useful to investigate the structure of the the matrix Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT.

Given a {\mathcal{B}}caligraphic_B-weakened independence model for I×J𝐼𝐽I\times Jitalic_I × italic_J contingency tables, we define a graph in the following way.

Definition 3.4.

Given a set {\mathcal{B}}caligraphic_B of adjacent minors, we define a graph Gsubscript𝐺G_{\mathcal{B}}italic_G start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT as follows: the set of vertices is the set of cells and each binomial defines 4 edges. The binomial pi,jpi+1,j+1pi,j+1pi+1,jsubscript𝑝𝑖𝑗subscript𝑝𝑖1𝑗1subscript𝑝𝑖𝑗1subscript𝑝𝑖1𝑗p_{i,j}p_{i+1,j+1}-p_{i,j+1}p_{i+1,j}italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j + 1 end_POSTSUBSCRIPT - italic_p start_POSTSUBSCRIPT italic_i , italic_j + 1 end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i + 1 , italic_j end_POSTSUBSCRIPT defines the edges (i,j)(i+1,j)normal-↔𝑖𝑗𝑖1𝑗(i,j)\leftrightarrow(i+1,j)( italic_i , italic_j ) ↔ ( italic_i + 1 , italic_j ), (i+1,j)(i+1,j+1)normal-↔𝑖1𝑗𝑖1𝑗1(i+1,j)\leftrightarrow(i+1,j+1)( italic_i + 1 , italic_j ) ↔ ( italic_i + 1 , italic_j + 1 ), (i,j+1)(i+1,j+1)normal-↔𝑖𝑗1𝑖1𝑗1(i,j+1)\leftrightarrow(i+1,j+1)( italic_i , italic_j + 1 ) ↔ ( italic_i + 1 , italic_j + 1 ) and (i,j)(i,j+1)normal-↔𝑖𝑗𝑖𝑗1(i,j)\leftrightarrow(i,j+1)( italic_i , italic_j ) ↔ ( italic_i , italic_j + 1 ).

The edges associated to a binomial are the 4444 sides of the square with vertices on the 4 cells involved in the binomial.

Definition 3.5.

A cell (i,j)𝑖𝑗(i,j)( italic_i , italic_j ) is a free cell if no edge of Gsubscript𝐺G_{\mathcal{B}}italic_G start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT involves (i,j)𝑖𝑗{(i,j)}( italic_i , italic_j ).

Equivalently, a cell (i,j)𝑖𝑗(i,j)( italic_i , italic_j ) is a free cell if and only if the indeterminate pi,jsubscript𝑝𝑖𝑗p_{i,j}italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT does not appear in any of the binomials in {\mathcal{B}}caligraphic_B.

Definition 3.6.

The sequence of cells (i,j),(i,j+1),(i,j+h)𝑖𝑗𝑖𝑗1normal-…𝑖𝑗(i,j),(i,j+1),\ldots(i,j+h)( italic_i , italic_j ) , ( italic_i , italic_j + 1 ) , … ( italic_i , italic_j + italic_h ) is a connected component of the i𝑖iitalic_i-th row if each pair of consecutive cells is connected by an edge of Gsubscript𝐺G_{\mathcal{B}}italic_G start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. The sequence forms a maximal connected row component (MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_R) if the sequence is no more connected when one adds (i,j1)𝑖𝑗1(i,j-1)( italic_i , italic_j - 1 ) or (i,j+h+1)𝑖𝑗1(i,j+h+1)( italic_i , italic_j + italic_h + 1 ).

One can define similarly the maximal connected column component (MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_C). We illustrate the definitions above with an example.

Example 3.7.

In the model for a 4×4444\times 44 × 4 contingency table defined through the binomials in Figure 3, we have 4444 MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, 5555 MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and 2 free cells.
















Figure 3: Binomials for Example 3.7.
Proposition 3.8.

Consider a {\mathcal{B}}caligraphic_B-weakened independence model with set of binomials {\mathcal{B}}caligraphic_B and let Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT be the matrix of the log-vectors of the minors in {\mathcal{B}}caligraphic_B. The indicator vectors of the free cells, the indicator vectors of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and the indicator vectors of the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs are orthogonal to the column space Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT.

Proof.

If (i,j)𝑖𝑗(i,j)( italic_i , italic_j ) is a free cell, then no monomial in {\mathcal{B}}caligraphic_B involves the corresponding variable. Hence the indicator vector of (i,j)𝑖𝑗(i,j)( italic_i , italic_j ) is orthogonal to the column space of Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. Given a MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_R, its indicator function is clearly orthogonal to the columns of Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT corresponding to minors not involving the cells of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_R. If a minor involves a cell of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_R, then it involves two cells with alternating signs. A similar argument works for MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs. Hence the orthogonality follows. ∎

Now, two questions arise: one about the linear independence of the vectors defined in Proposition 3.8 and the other about the dimension of the sub-vector space generated by such vectors. In other words, we have to investigate whether these vectors generate the space orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT or not. Let us start with two simple examples.

Example 3.9.

Consider a weakened independence model for 4×4444\times 44 × 4 tables defined through the adjacent minors in Figure 4.
















Figure 4: Binomials for Example 3.9.

In this situation, Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT has rank 3 and there are 4444 MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, 4444 MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and 6666 free cells. Here, the 14141414 vectors corresponding to the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, to the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and to the free cells generate a sub-vector space of dimension 13131313. Thus, they are enough to define the matrix Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT.

Example 3.10.

Consider now a weakened independence model for 4×4444\times 44 × 4 tables defined through the adjacent minors in Figure 5.
















Figure 5: Binomials for Example 3.10.

The model above only leaves out one minor, namely the central one. In this case, Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT has rank 8 and there are 4444 MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and 4 MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs. The 8888 vectors corresponding to the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and to the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs generate a sub-vector space of dimension 7777 and therefore they are not enough to generate the orthogonal space Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT.

The dimension of the vector space generated by the indicator function of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and the free cells can be computed and we have the following results.

Proposition 3.11.

For any connected component of {\mathcal{B}}caligraphic_B with r𝑟ritalic_r MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and c𝑐citalic_c MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs, the vector space generated by the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and by the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs has dimension (r+c1)𝑟𝑐1(r+c-1)( italic_r + italic_c - 1 ).

Proof.

Clearly the log-vectors of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and of the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs are not linearly independent as their sums are equal. To show that this is the only relation we proceed by induction on the number of minors in the connected component. Let this number be d𝑑ditalic_d. If d=1𝑑1d=1italic_d = 1 the result is trivial. Now, assume that the result holds for d𝑑ditalic_d. If the connected component involves d+1𝑑1d+1italic_d + 1 minors, let r1,,rtsubscript𝑟1subscript𝑟𝑡r_{1},\ldots,r_{t}italic_r start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_r start_POSTSUBSCRIPT italic_t end_POSTSUBSCRIPT be the indicator functions of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and c1,,cssubscript𝑐1subscript𝑐𝑠c_{1},\ldots,c_{s}italic_c start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_c start_POSTSUBSCRIPT italic_s end_POSTSUBSCRIPT be the indicator functions of the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs. Also assume that c1subscript𝑐1c_{1}italic_c start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT and r1subscript𝑟1r_{1}italic_r start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT involve the lex-smallest cell. Notice that c1subscript𝑐1c_{1}italic_c start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT and r1subscript𝑟1r_{1}italic_r start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT are the only vectors involving this cell. Given a linear combination

λici=μirisubscript𝜆𝑖subscript𝑐𝑖subscript𝜇𝑖subscript𝑟𝑖\sum\lambda_{i}c_{i}=\sum\mu_{i}r_{i}∑ italic_λ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT italic_c start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT = ∑ italic_μ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT italic_r start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT (3.1)

we must have λ1=μ1subscript𝜆1subscript𝜇1\lambda_{1}=\mu_{1}italic_λ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT = italic_μ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT. Then the linear combination (3.1) can be read in ={m¯}superscript¯𝑚{\mathcal{B}}^{\prime}={\mathcal{B}}\setminus\{\overline{m}\}caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT = caligraphic_B ∖ { over¯ start_ARG italic_m end_ARG }, where m¯¯𝑚\overline{m}over¯ start_ARG italic_m end_ARG is the minor involving the lex-smallest cell and the cisubscript𝑐𝑖c_{i}italic_c start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT’s and the risubscript𝑟𝑖r_{i}italic_r start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT’s represent the log-vectors of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs of superscript{\mathcal{B}^{\prime}}caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT. By the inductive hypothesis we get λi=μi=1subscript𝜆𝑖subscript𝜇𝑖1\lambda_{i}=\mu_{i}=1italic_λ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT = italic_μ start_POSTSUBSCRIPT italic_i end_POSTSUBSCRIPT = 1 for all i𝑖iitalic_i. ∎

As distinct connected components and free cells act on spaces which are orthogonal to each other, Proposition 3.11 leads to the following corollary.

Theorem 3.12.

Consider a {\mathcal{B}}caligraphic_B-weakened independence model defined by a set of binomials {\mathcal{B}}caligraphic_B whose graph has k𝑘kitalic_k connected components and with r𝑟ritalic_r MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, c𝑐citalic_c MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and f𝑓fitalic_f free cells. The dimension of the vector space generated by MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and the indicator functions of the free cells is (r+c+fk)𝑟𝑐𝑓𝑘(r+c+f-k)( italic_r + italic_c + italic_f - italic_k ).

Proof.

The indicators of the free cells are clearly independent with the indicators of the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and of the MRC𝑀𝑅𝐶MRCitalic_M italic_R italic_Cs. Moreover, indicators of MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs of different connected components are linearly independent as they do not share any cell. By Proposition 3.11 each connected component gives exactly one relation among the indicators of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs. Hence the result follows. ∎

In the results above, we have addressed dimensional issues. Now, we use them to find a procedure to determine a sufficient statistic. Moreover, the examples of this section show that in some cases the vectors of MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs, MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and free cells are sufficient to generate the space orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. Clearly, these vectors are not sufficient when the graph Gsubscript𝐺G_{\mathcal{B}}italic_G start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT of the binomials in {\mathcal{B}}caligraphic_B present a hole, i.e., when we remove some minors with 4 double edges from the complete set of binomials 𝒞𝒞{\mathcal{C}}caligraphic_C. Removing such a minor adds a new vector to the orthogonal. On the other hand, it does not add anything in terms of MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and free cells.

Thus, the last part of this section is devoted to actually find a sufficient statistic for a generic weakened independence model. The key idea is to start from the complete set of adjacent minors 𝒞𝒞{\mathcal{C}}caligraphic_C and to remove minors iteratively. This approach is motivated by the fact that for the complete set 𝒞𝒞{\mathcal{C}}caligraphic_C a sufficient statistic is known to be formed by the row sums and the column sums, as extensively discussed in Section 2.

We begin our analysis from a simple case. Namely, we consider a set of binomials {\mathcal{B}}caligraphic_B with given sufficient statistic Asubscript𝐴A_{{\mathcal{B}}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT and we investigate the behavior of the sufficient statistic when we remove one minor m𝑚mitalic_m from {\mathcal{B}}caligraphic_B, i.e., when the set of binomials is ={m}superscript𝑚{\mathcal{B}}^{\prime}={\mathcal{B}}\setminus\{m\}caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT = caligraphic_B ∖ { italic_m }. We separate two cases, depending on the number of double edges of the removed minor.

Lemma 3.13.

Consider a weakened independence model obtained removing a binomial with four double edges by a given family of adjacent binomials {\mathcal{B}}caligraphic_B, i.e. let ={m}superscriptnormal-′𝑚{\mathcal{B}}^{\prime}={\mathcal{B}}\setminus\{m\}caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT = caligraphic_B ∖ { italic_m } where m𝑚mitalic_m has four double edges. If we let Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT be the orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, then the orthogonal to Zsubscript𝑍superscriptnormal-′Z_{\mathcal{B}^{\prime}}italic_Z start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT is generated by the elements of Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT and by the indicator vector Q𝑄Qitalic_Q of a quadrant centered on one of the indeterminates of the removed minor.

Proof.

First notice that the elements of Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT are orthogonal to the columns of Zsubscript𝑍superscriptZ_{\mathcal{B}^{\prime}}italic_Z start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT, i.e. AAsubscript𝐴subscript𝐴superscriptA_{\mathcal{B}^{\prime}}\supseteq A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT ⊇ italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, and clearly, by Lemma 3.2, one has

dim(A)=dim(A)+1,dimensionsubscript𝐴superscriptdimensionsubscript𝐴1\dim(A_{\mathcal{B}^{\prime}})=\dim(A_{\mathcal{B}})+1\,,roman_dim ( italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT ) = roman_dim ( italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT ) + 1 ,

where Asubscript𝐴superscriptA_{\mathcal{B}^{\prime}}italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT is the orthogonal to Zsubscript𝑍superscriptZ_{\mathcal{B}^{\prime}}italic_Z start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT. Now let Q𝑄Qitalic_Q be the indicator vector of a quadrant centered on one of the indeterminates of m𝑚mitalic_m. Then, QA𝑄subscript𝐴Q\not\in A_{\mathcal{B}}italic_Q ∉ italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT as it is not orthogonal to the log-vector of m𝑚mitalic_m. But, QA𝑄subscript𝐴superscriptQ\in A_{\mathcal{B}^{\prime}}italic_Q ∈ italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT as each binomial in superscript\mathcal{B}^{\prime}caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT either avoid the quadrant, or it is contained in the quadrant, or has exactly two elements on the border of the quadrant. This is enough to complete the proof. ∎

The quadrant to be used in Example 3.10 is sketched Figure 6.

















\dashline[8]3(0,0)(0,-50)\dashline[8]3(0,0)(50,0)
Figure 6: Binomials of Example 3.10. The dashed line delimits the quadrant defined in Lemma 3.13.
Lemma 3.14.

Consider a weakened independence model obtained removing a binomial with not all the edges double by a given family of adjacent binomials {\mathcal{B}}caligraphic_B, i.e. let ={m}superscriptnormal-′𝑚{\mathcal{B}}^{\prime}={\mathcal{B}}\setminus\{m\}caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT = caligraphic_B ∖ { italic_m } where m𝑚mitalic_m has not all the edges double. If we let Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT be the orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, then the orthogonal to Zsubscript𝑍superscriptnormal-′Z_{\mathcal{B}^{\prime}}italic_Z start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT is generated by: the elements of Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, the indicator vectors of the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs, of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs and of the free cells.

Proof.

Clearly, the elements of Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT are orthogonal to the column of Zsubscript𝑍superscriptZ_{\mathcal{B}^{\prime}}italic_Z start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT, i.e. AAsubscript𝐴subscript𝐴superscriptA_{\mathcal{B}^{\prime}}\supseteq A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT ⊇ italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, and by Lemma 3.2 one has

dim(A)=dim(A)+1,dimensionsubscript𝐴superscriptdimensionsubscript𝐴1\dim(A_{\mathcal{B}^{\prime}})=\dim(A_{\mathcal{B}})+1\,,roman_dim ( italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT ) = roman_dim ( italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT ) + 1 ,

where Asubscript𝐴superscriptA_{\mathcal{B}^{\prime}}italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT is the orthogonal to Zsubscript𝑍superscriptZ_{\mathcal{B}^{\prime}}italic_Z start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT. The removed binomial m𝑚mitalic_m, with not all the edges double, can be one of the following

(d)\dashline[8]3(0,0)(0,28)(28,28)(28,0)(0,0)
(e)\dashline[8]3(0,0)(0,28)(28,28)(28,0)(0,0)
(a)\dashline[8]3(0,0)(0,28)(28,28)(28,0)(0,0)
(b)\dashline[8]3(0,0)(0,28)(28,28)(28,0)(0,0)
(c)\dashline[8]3(0,0)(0,28)(28,28)(28,0)(0,0)

and to complete the proof we only need to present, in each case, a vector Q𝑄Qitalic_Q in Asubscript𝐴superscriptA_{\mathcal{B^{\prime}}}italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT which is not in Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. In case (a), either we have a new free cell or not. If we have, let Q𝑄Qitalic_Q be the indicator vector of the free cell. Clearly, QA𝑄subscript𝐴Q\not\in A_{\mathcal{B}}italic_Q ∉ italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, but QA𝑄subscript𝐴superscriptQ\in A_{\mathcal{B^{\prime}}}italic_Q ∈ italic_A start_POSTSUBSCRIPT caligraphic_B start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT end_POSTSUBSCRIPT has no minor is involving the variable corresponding to the free cell. If we do not have a new free cell, then we have a new MMC𝑀𝑀𝐶MMCitalic_M italic_M italic_C or a new MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_R and its indicator vector is the required one. Repeating this kind of argument in cases (b) through (e) we complete the proof. ∎

We are now ready to analyze the general case.

Definition 3.15.

Let {\mathcal{B}}caligraphic_B be a set of adjacent minors and consider its complement ¯normal-¯\overline{\mathcal{B}}over¯ start_ARG caligraphic_B end_ARG in the set of all adjacent minors. Let Gsubscript𝐺G_{\mathcal{B}}italic_G start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT be the graph associated with ¯normal-¯\overline{\mathcal{B}}over¯ start_ARG caligraphic_B end_ARG. For each connected component of Gsubscript𝐺G_{\mathcal{B}}italic_G start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT not touching the border of the table, we consider the lex-smallest variable and we call it a corner.

Remark 3.16.

We notice that the number of corners is just the number of holes one can find in the graph defined by the set of monomials.

Theorem 3.17.

Let {\mathcal{B}}caligraphic_B be a set of adjacent minors. Then the orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT is generated by the indicator vectors of the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs, of the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, of the free cells and by quadrants centered in variables corresponding to corners.

Proof.

\mathcal{B}caligraphic_B can be constructed by the set of all the adjacent minors by removing a minor at each time. Using Lemmas 3.13 and 3.14 we only need to show the result for the set of all the adjacent minors, but this is a straightforward consequence of Lemma 3.2 and Theorem 3.12. ∎

Remark 3.18.

In alternative to the straightforward use of Theorem 3.17 one can apply Lemmas 3.14 and 3.13 to determine a sufficient statistic for a weakened independence model with set of binomial {\mathcal{B}}caligraphic_B. It is enough to start from the complete set of adjacent minors and remove one by one the minors not in {\mathcal{B}}caligraphic_B. Notice that such an iterative procedure, and the theorem itself, yield a system of generators of the space orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, but not a basis, i.e. some of the vectors we add are redundant.

We will show some examples and applications of Theorem 3.17 in the next sections.

4 Exponential models

In Section 3 we have carried out some computations to determine a sufficient statistic of a weakened independence model. We are now able to find a parametric representation of the model.

Let us introduce unrestricted positive parameters ζ1,,ζssubscript𝜁1subscript𝜁𝑠\zeta_{1},\ldots,\zeta_{s}italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_ζ start_POSTSUBSCRIPT italic_s end_POSTSUBSCRIPT, where s𝑠sitalic_s is the number of columns of the matrix Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. If Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT has full rank, then s𝑠sitalic_s coincide with the dimension of the vector sub-space orthogonal to Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT.

The first step is to prove that weakened independence models belong to the class of toric models and therefore they are exponential (log-linear) models on the strictly positive simplex. The first result in this direction is a rewriting of a general theorem to be found in geiger|meek|sturmfels:06 .

Remark 4.1.

The main result in geiger|meek|sturmfels:06 can be applied to statistical models when the matrix representation Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT of the sufficient statistic has non-negative entries. Therefore, the theory developed in Section 3 is relevant not only to actually determine a sufficient statistic, but also to derive further theoretical properties of the weakened independence models.

Here we use again a vector notation in order to improve the readability and simplify the formulae.

Theorem 4.2 (Geiger, Meek, Sturmfels (2006), Th. 3.2).

Given a {\mathcal{B}}caligraphic_B-weakened independence model, it can be expressed as

p(ζ)=ζA𝑝𝜁superscript𝜁subscript𝐴p(\zeta)=\zeta^{A_{\mathcal{B}}}italic_p ( italic_ζ ) = italic_ζ start_POSTSUPERSCRIPT italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT end_POSTSUPERSCRIPT (4.1)

apart from the normalizing constant.

Clearly, the parametrization in Eq. (4.1) is not unique. Theorem 4.2 provides an easy way to switch from the implicit representation to its parametrization. It is enough to consider the matrix Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, whose columns are orthogonal to the log-vectors of the binomials. As the columns of Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT can be chosen with non-negative entries, then each binomial in {\mathcal{B}}caligraphic_B vanishes in all points of the form given in Eq. (4.1). This follows from a direct substitution. The converse part is less intuitive and the proof is not obvious.

As a corollary, Theorem 4.2 allows us to consider weakened independence models into the larger class of toric models, as described in pistone|riccomagno|wynn:01 and rapallo:07 . In the following result, we summarize the main properties inherited from toric models.

Proposition 4.3.

Consider a {\mathcal{B}}caligraphic_B-weakened independence model Vsubscript𝑉V_{\mathcal{B}}italic_V start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT.

  1. 1.

    Vsubscript𝑉V_{\mathcal{B}}italic_V start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT is a toric model;

  2. 2.

    With the constraint p>0𝑝0p>0italic_p > 0, Vsubscript𝑉V_{\mathcal{B}}italic_V start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT is an exponential model;

  3. 3.

    In case of sampling, the sufficient statistic for the sample of size n𝑛nitalic_n is the sum of the sufficient statistic of all components of the sample.

Proof.

See Theorem 2 and the discussion in Section 3 of rapallo:07 . ∎

Remark 4.4.

As noticed in rapallo:07 , when we consider the general case p0𝑝0p\geq 0italic_p ≥ 0 instead of p>0𝑝0p>0italic_p > 0, the toric model is not an exponential model. Nevertheless it can be described as the disjoint union of a suitable number of exponential models.

We conclude this section with two examples.

Example 4.5.

As a first example, we consider a statistical model for 3×3333\times 33 × 3 contingency tables defined through the binomials in Figure 7.










Figure 7: Binomials for Example 4.5.

Using the theory developed in the previous section, the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, the MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and the free cells are sufficient to describe the orthogonal Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT and therefore the relevant matrices are in Table 1.

[Z|A]=(1010010000-10100010000000000010-100101000011010010000-10100010000000000010-1001010000000100100)delimited-[]conditionalsubscript𝑍subscript𝐴matrix1010010000-10100010000000000010-100101000011010010000-10100010000000000010-1001010000000100100[Z_{\mathcal{B}}\ |\ A_{\mathcal{B}}]=\begin{pmatrix}\begin{tabular}[]{cc|cccccccc}1&0&1&0&0&1&0&0&0&0\\ -1&0&1&0&0&0&1&0&0&0\\ 0&0&0&0&0&0&0&0&1&0\\ -1&0&0&1&0&1&0&0&0&0\\ 1&1&0&1&0&0&1&0&0&0\\ 0&-1&0&1&0&0&0&1&0&0\\ 0&0&0&0&0&0&0&0&0&1\\ 0&-1&0&0&1&0&1&0&0&0\\ 0&0&0&0&1&0&0&1&0&0\\ \end{tabular}\end{pmatrix}[ italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT | italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT ] = ( start_ARG start_ROW start_CELL start_ROW start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL end_ROW start_ROW start_CELL -1 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL end_ROW start_ROW start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL end_ROW start_ROW start_CELL -1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL end_ROW start_ROW start_CELL 1 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL end_ROW start_ROW start_CELL 0 end_CELL start_CELL -1 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL end_ROW start_ROW start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL end_ROW start_ROW start_CELL 0 end_CELL start_CELL -1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL end_ROW start_ROW start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL start_CELL 1 end_CELL start_CELL 0 end_CELL start_CELL 0 end_CELL end_ROW end_CELL end_ROW end_ARG )
Table 1: Matrices Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT and Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT for Example 4.5.

Thus, a parametrization with parameters ζ1,,ζ8subscript𝜁1subscript𝜁8\zeta_{1},\ldots,\zeta_{8}italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_ζ start_POSTSUBSCRIPT 8 end_POSTSUBSCRIPT is:

{p1,1=ζ1ζ4p1,2=ζ1ζ5p1,3=ζ7{p2,1=ζ2ζ4p2,2=ζ2ζ5p2,3=ζ2ζ6{p3,1=ζ8p3,2=ζ3ζ5p3,3=ζ3ζ6\left\{\begin{aligned} p_{1,1}=&\zeta_{1}\zeta_{4}\\ p_{1,2}=&\zeta_{1}\zeta_{5}\\ p_{1,3}=&\zeta_{7}\end{aligned}\right.\ \ \ \left\{\begin{aligned} p_{2,1}=&\zeta_{2}\zeta_{4}\\ p_{2,2}=&\zeta_{2}\zeta_{5}\\ p_{2,3}=&\zeta_{2}\zeta_{6}\end{aligned}\right.\ \ \ \left\{\begin{aligned} p_{3,1}=&\zeta_{8}\\ p_{3,2}=&\zeta_{3}\zeta_{5}\\ p_{3,3}=&\zeta_{3}\zeta_{6}\end{aligned}\right.{ start_ROW start_CELL italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 1 , 2 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 5 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 1 , 3 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 7 end_POSTSUBSCRIPT end_CELL end_ROW { start_ROW start_CELL italic_p start_POSTSUBSCRIPT 2 , 1 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 2 , 2 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 5 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 2 , 3 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 6 end_POSTSUBSCRIPT end_CELL end_ROW { start_ROW start_CELL italic_p start_POSTSUBSCRIPT 3 , 1 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 8 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 3 , 2 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 5 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 3 , 3 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 6 end_POSTSUBSCRIPT end_CELL end_ROW
Example 4.6.

Let us consider the weakened independence model for 4×4444\times 44 × 4 defined in Example 3.10. In that model, a minor with four double edges has been removed and consequently the MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and free cells are not sufficient to describe the orthogonal Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. A vector must be added according to Theorem 3.13. Following the same approach as in the previous example one can easily write down the matrices Zsubscript𝑍Z_{\mathcal{B}}italic_Z start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT and Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT. A parametrization with parameters ζ1,,ζ9subscript𝜁1subscript𝜁9\zeta_{1},\ldots,\zeta_{9}italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_ζ start_POSTSUBSCRIPT 9 end_POSTSUBSCRIPT is:

{p1,1=ζ1ζ5p1,2=ζ1ζ6p1,3=ζ1ζ7p1,4=ζ1ζ8{p2,1=ζ2ζ5p2,2=ζ2ζ6p2,3=ζ2ζ7p2,4=ζ2ζ8{p3,1=ζ3ζ5p3,2=ζ3ζ6p3,3=ζ3ζ7ζ9p3,4=ζ3ζ8ζ9{p4,1=ζ4ζ5p4,2=ζ4ζ6p4,3=ζ4ζ7ζ9p4,4=ζ4ζ8ζ9\left\{\begin{aligned} p_{1,1}=&\zeta_{1}\zeta_{5}\\ p_{1,2}=&\zeta_{1}\zeta_{6}\\ p_{1,3}=&\zeta_{1}\zeta_{7}\\ p_{1,4}=&\zeta_{1}\zeta_{8}\end{aligned}\right.\ \ \ \left\{\begin{aligned} p_{2,1}=&\zeta_{2}\zeta_{5}\\ p_{2,2}=&\zeta_{2}\zeta_{6}\\ p_{2,3}=&\zeta_{2}\zeta_{7}\\ p_{2,4}=&\zeta_{2}\zeta_{8}\end{aligned}\right.\ \ \ \left\{\begin{aligned} p_{3,1}=&\zeta_{3}\zeta_{5}\\ p_{3,2}=&\zeta_{3}\zeta_{6}\\ p_{3,3}=&\zeta_{3}\zeta_{7}\zeta_{9}\\ p_{3,4}=&\zeta_{3}\zeta_{8}\zeta_{9}\end{aligned}\right.\ \ \ \left\{\begin{aligned} p_{4,1}=&\zeta_{4}\zeta_{5}\\ p_{4,2}=&\zeta_{4}\zeta_{6}\\ p_{4,3}=&\zeta_{4}\zeta_{7}\zeta_{9}\\ p_{4,4}=&\zeta_{4}\zeta_{8}\zeta_{9}\end{aligned}\right.{ start_ROW start_CELL italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 5 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 1 , 2 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 6 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 1 , 3 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 7 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 1 , 4 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 8 end_POSTSUBSCRIPT end_CELL end_ROW { start_ROW start_CELL italic_p start_POSTSUBSCRIPT 2 , 1 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 5 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 2 , 2 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 6 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 2 , 3 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 7 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 2 , 4 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 8 end_POSTSUBSCRIPT end_CELL end_ROW { start_ROW start_CELL italic_p start_POSTSUBSCRIPT 3 , 1 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 5 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 3 , 2 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 6 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 3 , 3 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 7 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 9 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 3 , 4 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 8 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 9 end_POSTSUBSCRIPT end_CELL end_ROW { start_ROW start_CELL italic_p start_POSTSUBSCRIPT 4 , 1 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 5 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 4 , 2 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 6 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 4 , 3 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 7 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 9 end_POSTSUBSCRIPT end_CELL end_ROW start_ROW start_CELL italic_p start_POSTSUBSCRIPT 4 , 4 end_POSTSUBSCRIPT = end_CELL start_CELL italic_ζ start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 8 end_POSTSUBSCRIPT italic_ζ start_POSTSUBSCRIPT 9 end_POSTSUBSCRIPT end_CELL end_ROW

5 Inference and examples

In the previous sections we have defined and studied the weakened independence models. When the statistical model is given through a set of adjacent minors {\mathcal{B}}caligraphic_B, we are now able to compute a sufficient statistic for a sample of size 1111 (see Proposition 4.3) and to find a parametrization of the statistical model Vsubscript𝑉V_{\mathcal{B}}italic_V start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT (see Theorem 4.2.) In this section we give some ideas on how to compute maximum likelihood estimates (MLE) and to perform exact inference through Algebraic Statistics.

In the independence model defined by the set 𝒞𝒞{\mathcal{C}}caligraphic_C of all adjacent minors, the maximum likelihood estimate can be expressed in closed form in terms of the observed value of the sufficient statistic T𝑇Titalic_T. In the weakened independence models this is no longer true, but numerical algorithms for log-linear models can be used. As pointed out in Section 4, at least in the strictly positive case, a weakened independence model is log-linear and thus modified Newton-Raphson methods, Iterative Proportional Fitting or EM methods can be used, see e.g. agresti:02 . To compute the MLEs of of the cell probabilities for the examples in this paper, we have used the R software, see rproject:06 , together with the package gllm (generalized log-linear models), see duffy:06 . This package allows to define a generic matrix for the sufficient statistic. This is the main advantage of the gllm package with respect to other available procedures in different software systems.

Another theoretical result which highlights once again the interplay between statistical models and polynomial algebra is the Birch’s Theorem (see e.g. bishop|fienberg|holland:75 ). It states that the MLE is the unique point p^^𝑝\hat{p}over^ start_ARG italic_p end_ARG of the model Vsubscript𝑉V_{\mathcal{B}}italic_V start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT which satisfies the constraints Atp^=Atpobssuperscriptsubscript𝐴𝑡^𝑝superscriptsubscript𝐴𝑡subscript𝑝𝑜𝑏𝑠A_{\mathcal{B}}^{t}\hat{p}=A_{\mathcal{B}}^{t}p_{obs}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT over^ start_ARG italic_p end_ARG = italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT italic_p start_POSTSUBSCRIPT italic_o italic_b italic_s end_POSTSUBSCRIPT, where pobssubscript𝑝𝑜𝑏𝑠p_{obs}italic_p start_POSTSUBSCRIPT italic_o italic_b italic_s end_POSTSUBSCRIPT are the observed frequencies. We will have the opportunity to apply such result later in Example 5.3.

Once the MLE is available, the goodness-of-fit can be evaluated through a chi-squared test. The Pearson test statistic

C2=ni,j(pi,jp^i,j)2p^i,jsuperscript𝐶2𝑛subscript𝑖𝑗superscriptsubscript𝑝𝑖𝑗subscript^𝑝𝑖𝑗2subscript^𝑝𝑖𝑗C^{2}=n\sum_{i,j}\frac{(p_{i,j}-\hat{p}_{i,j})^{2}}{\hat{p}_{i,j}}italic_C start_POSTSUPERSCRIPT 2 end_POSTSUPERSCRIPT = italic_n ∑ start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT divide start_ARG ( italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT - over^ start_ARG italic_p end_ARG start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT ) start_POSTSUPERSCRIPT 2 end_POSTSUPERSCRIPT end_ARG start_ARG over^ start_ARG italic_p end_ARG start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT end_ARG (5.1)

or the log-likelihood ratio test statistic

G2=2ni,jpi,jlog(pi,jp^i,j)superscript𝐺22𝑛subscript𝑖𝑗subscript𝑝𝑖𝑗subscript𝑝𝑖𝑗subscript^𝑝𝑖𝑗G^{2}=2n\sum_{i,j}p_{i,j}\log\left(\frac{p_{i,j}}{{\hat{p}}_{i,j}}\right)italic_G start_POSTSUPERSCRIPT 2 end_POSTSUPERSCRIPT = 2 italic_n ∑ start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT roman_log ( divide start_ARG italic_p start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT end_ARG start_ARG over^ start_ARG italic_p end_ARG start_POSTSUBSCRIPT italic_i , italic_j end_POSTSUBSCRIPT end_ARG ) (5.2)

are evaluated and compared with the chi-square distribution with ##\#{\mathcal{B}}# caligraphic_B degrees of freedom, where ##\#{\mathcal{B}}# caligraphic_B is the cardinality of {\mathcal{B}}caligraphic_B, see haberman:74 or bishop|fienberg|holland:75 .

Alternatively, one can run the goodness-of-fit test within Algebraic Statistics, using a Markov Chains Monte Carlo (MCMC) algorithm. A number of papers have shown the relevance of this approach, see diaconis|sturmfels:98 , and e.g. rapallo:03 , aoki|takemura:05b , and chen|dinwoodie|dobra|huber:05 . The algebraic MCMC algorithm was first described in diaconis|sturmfels:98 , and it is by now widely used to compute non-asymptotic p𝑝pitalic_p-values for goodness-of-fit tests in contingency tables problems.

Let hhitalic_h be the observed contingency table for a sample of size n𝑛nitalic_n, written as a vector in IJsuperscript𝐼𝐽{\mathbb{N}}^{IJ}blackboard_N start_POSTSUPERSCRIPT italic_I italic_J end_POSTSUPERSCRIPT. The MCMC algorithm is useful to efficiently sample from the reference set tsubscript𝑡{\mathcal{F}}_{t}caligraphic_F start_POSTSUBSCRIPT italic_t end_POSTSUBSCRIPT of a contingency table hhitalic_h given a sufficient statistic with matrix representation Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, i.e., from the set

t={hIJ|Ath=Ath}.subscript𝑡conditional-setsuperscriptsuperscript𝐼𝐽superscriptsubscript𝐴𝑡superscriptsuperscriptsubscript𝐴𝑡{\mathcal{F}}_{t}=\left\{h^{\prime}\in{\mathbb{N}}^{IJ}\ |A_{\mathcal{B}}^{t}h^{\prime}=A_{\mathcal{B}}^{t}h\right\}\,.caligraphic_F start_POSTSUBSCRIPT italic_t end_POSTSUBSCRIPT = { italic_h start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT ∈ blackboard_N start_POSTSUPERSCRIPT italic_I italic_J end_POSTSUPERSCRIPT | italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT italic_h start_POSTSUPERSCRIPT ′ end_POSTSUPERSCRIPT = italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT italic_h } .

The algorithm samples tables from tsubscript𝑡{\mathcal{F}}_{t}caligraphic_F start_POSTSUBSCRIPT italic_t end_POSTSUBSCRIPT with the appropriate hypergeometric distribution {\mathcal{H}}caligraphic_H through a Markov chain based on a suitable set of moves making the chain connected. Such set of moves is called a Markov basis. With more details, a Markov basis is a set of tables {m1,,mL}subscript𝑚1subscript𝑚𝐿\{m_{1},\ldots,m_{L}\}{ italic_m start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_m start_POSTSUBSCRIPT italic_L end_POSTSUBSCRIPT } with integer entries such that:

  • Atmk=0superscriptsubscript𝐴𝑡subscript𝑚𝑘0A_{\mathcal{B}}^{t}m_{k}=0italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT italic_m start_POSTSUBSCRIPT italic_k end_POSTSUBSCRIPT = 0 for all k=1,,L𝑘1𝐿k=1,\ldots,Litalic_k = 1 , … , italic_L

  • if h1subscript1h_{1}italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT and h2subscript2h_{2}italic_h start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT are tables in tsubscript𝑡{\mathcal{F}}_{t}caligraphic_F start_POSTSUBSCRIPT italic_t end_POSTSUBSCRIPT, there exist moves mk1,,mkAsubscript𝑚subscript𝑘1subscript𝑚subscript𝑘𝐴m_{k_{1}},\ldots,m_{k_{A}}italic_m start_POSTSUBSCRIPT italic_k start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT end_POSTSUBSCRIPT , … , italic_m start_POSTSUBSCRIPT italic_k start_POSTSUBSCRIPT italic_A end_POSTSUBSCRIPT end_POSTSUBSCRIPT and signs ϵ1,,ϵAsubscriptitalic-ϵ1subscriptitalic-ϵ𝐴\epsilon_{1},\ldots,\epsilon_{A}italic_ϵ start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_ϵ start_POSTSUBSCRIPT italic_A end_POSTSUBSCRIPT (ϵa=±1subscriptitalic-ϵ𝑎plus-or-minus1\epsilon_{a}=\pm 1italic_ϵ start_POSTSUBSCRIPT italic_a end_POSTSUBSCRIPT = ± 1) such that

    h2=h1+a=1Aϵamka and h1+a=1lϵamka0 for all l=1,,A.formulae-sequenceformulae-sequencesubscript2subscript1superscriptsubscript𝑎1𝐴subscriptitalic-ϵ𝑎subscript𝑚subscript𝑘𝑎 and subscript1superscriptsubscript𝑎1𝑙subscriptitalic-ϵ𝑎subscript𝑚subscript𝑘𝑎0 for all 𝑙1𝐴h_{2}=h_{1}+\sum_{a=1}^{A}\epsilon_{a}m_{k_{a}}\ \ \mbox{ and }\ \ h_{1}+\sum_{a=1}^{l}\epsilon_{a}m_{k_{a}}\geq 0\ \mbox{ for all }l=1,\ldots,A\,.italic_h start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT = italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT + ∑ start_POSTSUBSCRIPT italic_a = 1 end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_A end_POSTSUPERSCRIPT italic_ϵ start_POSTSUBSCRIPT italic_a end_POSTSUBSCRIPT italic_m start_POSTSUBSCRIPT italic_k start_POSTSUBSCRIPT italic_a end_POSTSUBSCRIPT end_POSTSUBSCRIPT and italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT + ∑ start_POSTSUBSCRIPT italic_a = 1 end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_l end_POSTSUPERSCRIPT italic_ϵ start_POSTSUBSCRIPT italic_a end_POSTSUBSCRIPT italic_m start_POSTSUBSCRIPT italic_k start_POSTSUBSCRIPT italic_a end_POSTSUBSCRIPT end_POSTSUBSCRIPT ≥ 0 for all italic_l = 1 , … , italic_A .

These conditions ensure the irreducibility of the Markov chain defined by the algorithm below:

  • Start from a table h1tsubscript1subscript𝑡h_{1}\in{\mathcal{F}}_{t}italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT ∈ caligraphic_F start_POSTSUBSCRIPT italic_t end_POSTSUBSCRIPT;

  • Choose a move mksubscript𝑚𝑘m_{k}italic_m start_POSTSUBSCRIPT italic_k end_POSTSUBSCRIPT uniformly in {m1,,mL}subscript𝑚1subscript𝑚𝐿\{m_{1},\ldots,m_{L}\}{ italic_m start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_m start_POSTSUBSCRIPT italic_L end_POSTSUBSCRIPT } and a sign ϵitalic-ϵ\epsilonitalic_ϵ uniformly in {1,1}11\{-1,1\}{ - 1 , 1 }. Define h2=h1+ϵmksubscript2subscript1italic-ϵsubscript𝑚𝑘h_{2}=h_{1}+\epsilon m_{k}italic_h start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT = italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT + italic_ϵ italic_m start_POSTSUBSCRIPT italic_k end_POSTSUBSCRIPT;

  • Choose u𝑢uitalic_u uniformly distributed in the interval [0,1]01[0,1][ 0 , 1 ]. If h20subscript20h_{2}\geq 0italic_h start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT ≥ 0 and min{1,H(h2)/H(h1)}>u1𝐻subscript2𝐻subscript1𝑢\min\{1,H(h_{2})/H(h_{1})\}>uroman_min { 1 , italic_H ( italic_h start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT ) / italic_H ( italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT ) } > italic_u then move from h1subscript1h_{1}italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT to h2subscript2h_{2}italic_h start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT, otherwise stay at h1subscript1h_{1}italic_h start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT.

In the general case, the computation of a Markov basis needs symbolic computations (the Diaconis-Sturmfels algorithm). Nevertheless, a Markov basis for the weakened independence models can be derived theoretically. In the following, we will determine a Markov basis for the weakened independence models.

Given the set {\mathcal{B}}caligraphic_B of binomials defining the {\mathcal{B}}caligraphic_B-weakened independence model, let Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT be the matrix representation of the sufficient statistic. Moreover, we denote by subscript{\mathcal{I}}_{\mathcal{B}}caligraphic_I start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT the polynomial ideal in [p]delimited-[]𝑝{\mathbb{R}}[p]blackboard_R [ italic_p ] generated by the binomials in {\mathcal{B}}caligraphic_B. Diaconis and Sturmfels (diaconis|sturmfels:98 , Theorem 3.13.13.13.1) proved that a Markov basis is formed by the log-vectors of a set of generators of the toric ideal associated to Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT, i.e. the ideal

𝒥={papb|a,bIJ,At(a)=At(b)}.subscript𝒥conditional-setsuperscript𝑝𝑎superscript𝑝𝑏formulae-sequence𝑎𝑏superscript𝐼𝐽superscriptsubscript𝐴𝑡𝑎superscriptsubscript𝐴𝑡𝑏{\mathcal{J}}_{\mathcal{B}}=\{p^{a}-p^{b}\ |\ a,b\in{\mathbb{R}}^{IJ}\ ,\ A_{\mathcal{B}}^{t}(a)=A_{\mathcal{B}}^{t}(b)\}.caligraphic_J start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT = { italic_p start_POSTSUPERSCRIPT italic_a end_POSTSUPERSCRIPT - italic_p start_POSTSUPERSCRIPT italic_b end_POSTSUPERSCRIPT | italic_a , italic_b ∈ blackboard_R start_POSTSUPERSCRIPT italic_I italic_J end_POSTSUPERSCRIPT , italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT ( italic_a ) = italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT ( italic_b ) } .

Therefore, the computation of a Markov basis translates into the computation of a set of generators of a toric ideal.

Bigatti et al. bigatti|lascala|robbiano:99 showed that the toric ideal associated to Asubscript𝐴A_{\mathcal{B}}italic_A start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT is the saturation of subscript{\mathcal{I}}_{\mathcal{B}}caligraphic_I start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT with respect to the product of the indeterminates. Such ideal is defined as:

:(p1,1pI,J)={f[p]|(p1,1pI,J)nf for some n}.:subscriptsuperscriptsubscript𝑝11subscript𝑝𝐼𝐽conditional-set𝑓delimited-[]𝑝superscriptsubscript𝑝11subscript𝑝𝐼𝐽𝑛𝑓subscript for some 𝑛{\mathcal{I}}_{\mathcal{B}}:(p_{1,1}\cdots p_{I,J})^{\infty}=\left\{f\in\mathbb{R}[p]\ |\ (p_{1,1}\cdots p_{I,J})^{n}f\in{\mathcal{I}}_{\mathcal{B}}\mbox{ for some }n\right\}.caligraphic_I start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT : ( italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT ⋯ italic_p start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT ) start_POSTSUPERSCRIPT ∞ end_POSTSUPERSCRIPT = { italic_f ∈ blackboard_R [ italic_p ] | ( italic_p start_POSTSUBSCRIPT 1 , 1 end_POSTSUBSCRIPT ⋯ italic_p start_POSTSUBSCRIPT italic_I , italic_J end_POSTSUBSCRIPT ) start_POSTSUPERSCRIPT italic_n end_POSTSUPERSCRIPT italic_f ∈ caligraphic_I start_POSTSUBSCRIPT caligraphic_B end_POSTSUBSCRIPT for some italic_n } .

In order to compute a set of generators of this ideal, one can use symbolic algebra packages, e.g. the function Toric of CoCoA. For further details on ideals and their operations, see e.g. cox|little|oshea:92 and kreuzer|robbiano:00 .

Example 5.1.

The data we present as a first example in this section have been collected by one of the authors in his Biostatistics course. Each of the 34343434 students must submit a homework before the exam and this report is evaluated by two instructors on a scale with levels {1,2,3}123\{1,2,3\}{ 1 , 2 , 3 }. The final grade is the maximum of the two evaluations. The data are in the Table 2.

Second instructor First instructor
1111 2222 3333 Total
1111 7777 5555 00 12121212
(6.52)6.52(6.52)( 6.52 ) (5.48)5.48(5.48)( 5.48 ) (0)0(0)( 0 )
2222 4444 5555 2222 11111111
(4.48)4.48(4.48)( 4.48 ) (3.76)3.76(3.76)( 3.76 ) (2.76)2.76(2.76)( 2.76 )
3333 1111 5555 5555 11111111
(1)1(1)( 1 ) (5.76)5.76(5.76)( 5.76 ) (4.24)4.24(4.24)( 4.24 )
Total 12 15 7 34
Table 2: Evaluation of 34343434 homeworks by two instructors. In parentheses are the the MLE estimates for the weakened independence model.

The model we use to analyze such data is the model defined by the adjacent minors in Example 4.5. Using the gllm package, we obtain the MLEs written in parentheses in the table. The Pearson statistic is 0.98630.98630.98630.9863. Running a MCMC algorithm with a Markov basis consisting of 2222 moves, we find a p𝑝pitalic_p-value of 0.66650.66650.66650.6665 for the goodness-of-fit test, showing a good fit. The Monte Carlo computations are based on a sample of 10,0001000010,00010 , 000 tables, with a burn-in phase of 50,0005000050,00050 , 000 tables and sampling every 50505050 steps.

Models of this kind are used in carlini|rapallo:08 to detect category indistinguishability both in intra-rater and in inter-rater agreement problems. The model we used shows that categories 1111 and 2222 are confused, as well as categories 2222 and 3333. This lack of distinguishability can be ascribed to a relevant non-homogeneity of the marginal distributions.

Example 5.2.

The data in Table 3 show the cross-classification of 103103103103 subjects with respect to 2222 ordinal variables: the smoking level, 4444 categories from “No Smoking” to “More than 10101010 cigarettes”, and the quantity of High-Density Lipoprotein Cholesterol (HDLP) in the blood, 4444 categories from “Normal” to “Abnormal”. The data are presented in jeong|jhun|kim:05 and analyzed by the authors under both the independence model and the RC (Row Column effects) model. The authors compute the exact p𝑝pitalic_p-values for the independence model (0.049) and for the RC model (0.657) using the log-likelihood ratio test statistic.

Smoking level HDLC
1111 2222 3333 4444 Total
1111 15151515 3333 6666 1111 25
2222 8888 4444 7777 2222 21212121
3333 11111111 6666 15151515 3333 35353535
4444 5555 1111 11111111 5555 22222222
Total 39393939 14141414 39393939 11111111 103103103103
Table 3: Cross-classification of Smoking level and HDLC. Smoking levels: 1=1absent1=1 =“No Smoking”, 2=2absent2=2 =“Less than 5555 cigarettes”, 3=3absent3=3 =“Less than 10101010 cigarettes”, 4=4absent4=4 =“More than 10101010 cigarettes”. HDLC levels: 1=1absent1=1 =“Normal”, 2=2absent2=2 =“Low Normal”, 3=3absent3=3 =“Borderline”, 4=4absent4=4 =“Abnormal”.

We use a weakened independence model with binomials in Figure 8. According to Theorem 3.17, a sufficient statistic is formed by 4444 MCR𝑀𝐶𝑅MCRitalic_M italic_C italic_Rs, 4444 MCC𝑀𝐶𝐶MCCitalic_M italic_C italic_Cs and 3333 free cells. Moreover, the relevant Markov basis has 14141414 binomials.
















Figure 8: Weakened independence model for the cholesterol data.

With our model we find a p𝑝pitalic_p-value of 0.72050.72050.72050.7205. Therefore, this weakened independence model fits better than the independence model and it is as good as the RC model. In particular, removing only three adjacent minors from the complete configuration with 9 minors, we obtain a model whose fit is dramatically improved. Moreover, the removed minors allow us to identify quickly the cells which cause the departure from independence.

Example 5.3.

To conclude this section, we show how the models defined in the present paper have some relationships with a recent problem, first stated by Bernd Sturmfels in 2005200520052005 and known as the “100 Swiss Francs Problem”, see sturmfels:07 . Such problem is related to the modelling of DNA sequence alignments. We briefly describe the probabilistic experiment. For a plain description, the reader can refer to patcher|sturmfels:05 , Example 1.151.151.151.15.

A DNA sequence is a sequence of symbols in the alphabet {{\{{A, T, C, G}normal-}\}}. A major problem in molecular biology is to compare two DNA sequences. In sturmfels:07 , the following observed sequences were considered:

ATCACCAAACATTGGGATGCCTGTGCATTTGCAAGCGGCT

ATGAGTCTTAAAACGCTGGCCATGTCCATCTTAGACAGCG

leading to the observed table below:

(4222242222422224)matrix4222242222422224\begin{pmatrix}\begin{tabular}[]{cccc}4&2&2&2\\ 2&4&2&2\\ 2&2&4&2\\ 2&2&2&4\end{tabular}\end{pmatrix}( start_ARG start_ROW start_CELL start_ROW start_CELL 4 end_CELL start_CELL 2 end_CELL start_CELL 2 end_CELL start_CELL 2 end_CELL end_ROW start_ROW start_CELL 2 end_CELL start_CELL 4 end_CELL start_CELL 2 end_CELL start_CELL 2 end_CELL end_ROW start_ROW start_CELL 2 end_CELL start_CELL 2 end_CELL start_CELL 4 end_CELL start_CELL 2 end_CELL end_ROW start_ROW start_CELL 2 end_CELL start_CELL 2 end_CELL start_CELL 2 end_CELL start_CELL 4 end_CELL end_ROW end_CELL end_ROW end_ARG ) (5.3)

The hypothesis of the author is that such two DNA sequences are generated through a (biased) coin and four tetrahedral dice D1,D2,D3,D4subscript𝐷1subscript𝐷2subscript𝐷3subscript𝐷4D_{1},D_{2},D_{3},D_{4}italic_D start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , italic_D start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT , italic_D start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT , italic_D start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT with the letters A, T, C, G on the facets. When the coin outcome is “Head”, then the dice D1subscript𝐷1D_{1}italic_D start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT and D2subscript𝐷2D_{2}italic_D start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT are rolled. The outcome of D1subscript𝐷1D_{1}italic_D start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT is registered in the first sequence and the outcome of D2subscript𝐷2D_{2}italic_D start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT in the second one. When the coin outcome is “Tail”, then the dice D3subscript𝐷3D_{3}italic_D start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT and D4subscript𝐷4D_{4}italic_D start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT are rolled.

Denote by q1,,q4subscript𝑞1subscript𝑞4q_{1},\ldots,q_{4}italic_q start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT , … , italic_q start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT the probability vectors of the four dice and by α𝛼\alphaitalic_α the probability of “Head” in the coin. Then, the probability distribution of the final outcome is

αq1q2t+(1α)q3q4t.𝛼subscript𝑞1superscriptsubscript𝑞2𝑡1𝛼subscript𝑞3superscriptsubscript𝑞4𝑡\alpha q_{1}q_{2}^{t}+(1-\alpha)q_{3}q_{4}^{t}\,.italic_α italic_q start_POSTSUBSCRIPT 1 end_POSTSUBSCRIPT italic_q start_POSTSUBSCRIPT 2 end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT + ( 1 - italic_α ) italic_q start_POSTSUBSCRIPT 3 end_POSTSUBSCRIPT italic_q start_POSTSUBSCRIPT 4 end_POSTSUBSCRIPT start_POSTSUPERSCRIPT italic_t end_POSTSUPERSCRIPT . (5.4)

Therefore, the construction of this experiment leads us to consider the statistical model of 4×4444\times 44 × 4 matrices of probabilities whose rank is less than or equal to 2222. The author conjectured that the maximum likelihood estimate of the probabilities under the model of matrices with rank at most 2222 is:

P^g=140(3322332222332233)subscript^𝑃𝑔140matrix3322332222332233\hat{P}_{g}=\frac{1}{40}\begin{pmatrix}\begin{tabular}[]{cccc}3&3&2&2\\ 3&3&2&2\\ 2&2&3&3\\ 2&2&3&3\end{tabular}\end{pmatrix}over^ start_ARG italic_P end_ARG start_POSTSUBSCRIPT italic_g end_POSTSUBSCRIPT = divide start_ARG 1 end_ARG start_ARG 40 end_ARG ( start_ARG start_ROW start_CELL start_ROW start_CELL 3 end_CELL start_CELL 3 end_CELL start_CELL 2 end_CELL start_CELL 2 end_CELL end_ROW start_ROW start_CELL 3 end_CELL start_CELL 3 end_CELL start_CELL 2 end_CELL start_CELL 2 end_CELL end_ROW start_ROW start_CELL 2 end_CELL start_CELL 2 end_CELL start_CELL 3 end_CELL start_CELL 3 end_CELL end_ROW start_ROW start_CELL 2 end_CELL start_CELL 2 end_CELL start_CELL 3 end_CELL start_CELL 3 end_CELL end_ROW end_CELL end_ROW end_ARG ) (5.5)

Further analyses to be found in fienberg|hersh|rinaldo|zhou:07 show that the model is non-identifiable and that numerical methods are able to identify 3333 global maxima and 4444 local maxima for the likelihood function. Apart from the simultaneous permutation of the row and column labels, the global maximum is reached for the matrix in Eq. (5.5) and the local maximum is obtained by the matrix:

P^l=140(8/38/38/328/38/38/328/38/38/3