Funnels in Energy Landscapes

Abstract

Local minima and the saddle points separating them in the energy landscape are known to dominate the dynamics of biopolymer folding. Here we introduce a notion of a “folding funnel” that is concisely defined in terms of energy minima and saddle points, while at the same time conforming to a notion of a “folding funnel” as it is discussed in the protein folding literature.

1 Introduction

The dynamics of structure formation (“folding”) of biopolymers, both protein and nucleic acids, can be understood in terms of their energy landscapes. Formally, a landscape is determined by a set $X$ of conformations or states, a neighborhood structure of $X$ that encodes which conformations can be reached from which other ones, and an energy function $E:X\to\mathbb{R}$ which assigns the folding energy to each state. In the case of nucleic acids it has been demonstrated that dynamics features of the folding process can be derived at least in a good approximation by replacing the full landscape by the collection of local minima and their connecting saddle points Wolfinger:04a .

The notion of a “folding funnel” has a long history in the protein folding literature Bryngelson:87 ; Leopold:92 ; Onuchic:97 ; Galzitskaya:99 ; Onuchic:00 . It arose from the observation that the folding process of naturally evolved proteins very often follows simple empirical rules that seem to bypass the complexity of the vast network of elementary steps that is required in general to describe the folding process on rugged energy landscapes. Traditionally, the funnel is depicted as a relation of folding energy and “conformational entropy”, alluding to the effect that the energy decreases, on average, as structures are formed that are more and more similar to the native structure of a natural protein Onuchic:04 . It may come as a surprise therefore, that despite the great conceptual impact of the notion of a folding funnel in protein folding research, there does not seem to be a clear mathematical definition of “funnel”. Intuitively, one would expect that a funnel should be defined in terms of the basins and barriers of the fitness landscape (since, as mentioned above, these coarse-grained topological features determine the folding dynamics). Furthermore, it should imply the “funneling” of folding trajectories towards the ground state of the molecule.

2 Folding Dynamics as a Markov Chain

We consider here only finite discrete conformations spaces $X$ with a prescribed set of elementary moves of transitions that inter-convert conformations. In the following we write $M(x)$ for the set of conformations accessible from $x\in X$. For example, $X=\{-1,+1\}^{N}$ in spin-glass setting, where flipping single spins is the natural definition of a move. In the case of RNA or protein folding, the breaking and formation of individual contacts between nucleotides or amino acids, resp., is the most natural type of move set Flamm:00a .

The dynamics on $X$ is modeled as usual by the 1st order Markov chain with Metropolis transition probabilities

$$\begin{split}p(y|x)&=\frac{1}{|M(x)|}\min\{1,\exp(-\beta(E_{y}-E_{x}))\}\qquad\textrm{for }y\in M(x)\\ p(x|x)&=1-\sum_{y\in M(x)}p(y|x)\end{split}$$ (1)

All other transition probabilities are zero.

We will be interested in the average time $\tau_{x}$ the system takes to reach a pre-defined target state $x_{0}\in X$ when starting at state $x\in X$, given by the recurrence

$$\tau_{x}=\sum_{y\in M(x)}p(y|x)\tau_{y}+p(x|x)\tau_{x}+1$$ (2)

with $\tau_{0}=0$ (target state).

Figure 1: (a-d) Dynamics on one-dimensional energy landscapes $E(x)$ (thick curves). Thin curves show the average first passage time for state $x_{0}=0$ when starting from given state $x$, for temperatures $\beta=0$ (circle), $\beta=1$ (square), $\beta=2$ (diamond), $\beta=3$ (triangle up), $\beta=4$ (triangle left). R.h.s. panel: temperature dependence of first passage times in the landscapes (a-d); $\tau_{\rm max}$ is the average time to reach $x_{0}$ for the first time starting at the “rightmost” state $x=19$. Slight changes in the slopes or other details of the landscapes $E(x)$ do not change the qualitative behavior of $\tau_{\rm max}$ as long as the ordering of barrier heights is conserved.

In order to investigate the physical basis of the “funneling effect” we start with a simple 1-dimensional toy model with landscapes defined over the integers $\{0,\dots\,n\}$, see Fig. 1. The time $\tau$ to target crucially depends on the ordering of barriers. The time to target is shortest when barriers are decreasing towards the ground state as in panel (c) of Fig. 1. The property of decreasing barriers towards the ground state matches the intuition of folding funnels. In the following section we generalize it to arbitrary landscapes.

3 Geometric Funnels

A conformation $x\in X$ is a local minimum if $E_{x}\leq E_{y}$ for all $y\in M(x)$. Allowing equality is a mere mathematical convenience Flamm:02a . Let $\mathbb{P}_{xy}$ be the set of all walks from $x$ to $y$. We say that $x$ and $y$ are mutually accessible at level $\eta$, in symbols

$$x\,\hbox{$\looparrowleft\!\!\!\!\underline{\,\,\,\,{}^{\eta}\,\,\,\,}\!\!\!\!\looparrowright$}\,y\,,$$ (3)

if there is walk $\mathbf{p}\in\mathbb{P}_{xy}$ such that $E_{z}\leq\eta$ for all $z\in\mathbf{p}$, respectively. The saddle height $\hat{f}(x,y)$ between two configurations $x,y\in X$ is the minimum height at which they are accessible from each other, i.e.,

$$\hat{f}(x,y)=\min_{\mathbf{p}\in\mathbb{P}_{xy}}\max_{z\in\mathbf{p}}E_{z}=\min\{\eta|x\,\hbox{$\looparrowleft\!\!\!\!\underline{\,\,\,\,{}^{\eta}\,\,\,\,}\!\!\!\!\looparrowright$}\,y\}$$ (4)

The saddles between $x$ and $y$ are exactly the maximal points along the minimal paths in the equation above. We say, furthermore, that a saddle point $s$ directly connects the local minima $x$ and $y$, if there are paths $\mathbf{p}_{sx}$ and $\mathbf{p}_{sy}$ from $s$ to $x$ and $y$, respectively, such that $E$ is monotonically decreasing along both $\mathbf{p}_{sx}$ and $\mathbf{p}_{sy}$.

Figure 2: Fraction of minima belonging to the funnel vs. the total number of minima found in the landscape. RNA hairpins (filled squares) and RNAs with two different near-ground state structures (filled circles). The straight line has slope -1. Landscapes with only the ground state in the funnel fall on this line. Open symbols are the results for the number partitioning problem with (NPP) with sizes $n=8$ (circles), $n=10$ (squares) and $n=12$ (triangles). For each system size, 30 instances were generated by drawing random numbers $a_{1},a_{2},\dots,a_{n}$ and $c$ independently from the unit interval. The energy for a state $(x_{1},\dots,x^{N})\in\{-1,1\}$ is $E(x)=|\sum_{i=1}^{n}x_{i}a_{i}+c|$. The $c$ represents an extra “clamped” degree of freedom to break the symmetry under reversal of all spins. This ensures that almost all instances have a unique ground state.

For simplicity we assume the following weak non-degeneracy condition for our energy landscape: For every local minimum $x$ there is a unique saddle point $s_{x}$ of minimal height $h(x)=\min_{z}\hat{f}(x,z)$. Note that $s_{x}$ is necessarily a direct saddle between $x$ and some other local minimum $z$, which for simplicity we again assume to be uniquely determined. This condition is stronger than local non-degeneracy but weaker than global non-degeneracy in the sense of Flamm:02a . In the degenerate case, we consider the set of all direct saddles of minimum height and the set of the local minima directly connected to them.

Now we can define the funnel of a landscape recursively as the following set $F$ of states:

• The ground state is contained in the funnel $F$.

• The local minimum $x$ belongs to the funnel $F$ if a minimum saddle $s_{x}$ connects directly to local minimum in the funnel $F$.

• A state $z$ belongs to the funnel if it is connected by a gradient descent path to a local minimum in $F$.

Using the above definition, we can recursively partition the landscape into “local funnels”: Simply remove $F$ from $X$ and recompute the funnel of the residual landscape.

Figure 3: Funnel partitioning for the folding landscape of the RNA sequence xbix (CUGCGGCUUUGGCUCUAGCC). The landscape falls into three funnels. In Wolfinger:04a it was shown that a large part of the folding trajectories reach the metastable state 2 whose energy lies 0.8 kcal above the energy of the ground state 1.

As one example of biopolymers we consider small artificial RNA sequences which have been designed either to fold into a single stable hairpin structure or to have two near-ground state structures that have very few base pairs in common. In the first case we expect landscapes dominated by funnels because the RNAinverse algorithm Hofacker:94a tends to produce robustly folding sequences. In the second case we used the design procedure outlined in Flamm:00b to produce sequences that have decoy structures with moderate to large basins of attraction. The sequences we use here have a length of 30nt or less, shorter than most structured RNAs of biological importance.

The barriers algorithm, which efficiently computes local minima and their separating saddle points from an energy-sorted list of states Flamm:00a can be modified to compute the funnel-partitioning of the energy landscapes. We will report on this topic elsewhere.

Figure 2 shows the fraction of local minima contained in the funnels of several landscapes. The RNA folding landscapes have folding funnels comprising a large part of the landscape. The landscapes of RNA sequences forming hairpins have the largest funnels. In comparison we plot the relative sizes of funnels for number partitioning problems of different sizes, as defined in the caption of Fig. 2. These artificial landscapes have significantly smaller funnels than the RNA folding landscapes. Thus the latter have folding funnels much larger than expected for random rugged landscapes. Through these large funnels the folding polymer may be “guided” towards the native state.

Figure 3 shows an example of an RNA sequence with a strong kinetic trap studied in detail in Wolfinger:04a . In this landscape, a suboptimal structure has local funnel that covers most of the landscape, while the ground state is separated by comparably high barriers from almost all other local optima.

In summary, we have introduced here a rigorous definition of a folding funnel that is tractable computationally for arbitrary energy landscapes. In the case of RNA, where the lower fraction of the landscape can be generated without the need for exhaustively enumerating all configurations Wuchty:99 , funnels can be computed explicitly even for sequences that are of immediate biological interest. Our first computational results show that the energy landscapes of RNAs typically differ from the rugged landscapes of spinglass-style combinatorial optimization problems by exhibiting significantly larger funnels for the ground state. It remains to be investigated in future work whether this is also true e.g. for lattice protein models. A second important topic of ongoing research is the question which and to what extent evolutionary processes select molecules with funnel-like landscapes.

Acknowledgments. This work was supported in part by the EMBIO project in FP-6 (http://www-embio.ch.cam.ac.uk/).